FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640795_at:

>probe:Drosophila_2:1640795_at:480:377; Interrogation_Position=1047; Antisense; GAAGCTGAGCAACCAGGCTGTTATT
>probe:Drosophila_2:1640795_at:21:129; Interrogation_Position=1058; Antisense; ACCAGGCTGTTATTCAAGGCAAGGA
>probe:Drosophila_2:1640795_at:450:161; Interrogation_Position=1100; Antisense; ACAATTACTGGTGTCCAACGCGTCT
>probe:Drosophila_2:1640795_at:614:253; Interrogation_Position=1115; Antisense; CAACGCGTCTGATCACCGAGGAGGT
>probe:Drosophila_2:1640795_at:414:435; Interrogation_Position=1135; Antisense; GAGGTGGACTACGAGTTCCCGCTGC
>probe:Drosophila_2:1640795_at:254:633; Interrogation_Position=1151; Antisense; TCCCGCTGCCGGGTGGCGATCAATT
>probe:Drosophila_2:1640795_at:511:43; Interrogation_Position=1196; Antisense; ATCGACTGGGCATGTGCTACGAGGC
>probe:Drosophila_2:1640795_at:655:193; Interrogation_Position=1234; Antisense; AACTGTATTCTGAAGGGCAGCACGG
>probe:Drosophila_2:1640795_at:156:355; Interrogation_Position=1253; Antisense; GCACGGAGAGCGATGACTTCAGTCA
>probe:Drosophila_2:1640795_at:612:89; Interrogation_Position=1273; Antisense; AGTCACAACGAGAGTCTGCTGCTGG
>probe:Drosophila_2:1640795_at:572:237; Interrogation_Position=1300; Antisense; AATCTGATGGACACCATTCACGCCG
>probe:Drosophila_2:1640795_at:311:273; Interrogation_Position=1314; Antisense; CATTCACGCCGAACTGGGAGTCGGT
>probe:Drosophila_2:1640795_at:729:431; Interrogation_Position=1331; Antisense; GAGTCGGTGAATTCGCCAATCGCAA
>probe:Drosophila_2:1640795_at:683:43; Interrogation_Position=1349; Antisense; ATCGCAACGAGGTTTCAGATCTGCA

Paste this into a BLAST search page for me
GAAGCTGAGCAACCAGGCTGTTATTACCAGGCTGTTATTCAAGGCAAGGAACAATTACTGGTGTCCAACGCGTCTCAACGCGTCTGATCACCGAGGAGGTGAGGTGGACTACGAGTTCCCGCTGCTCCCGCTGCCGGGTGGCGATCAATTATCGACTGGGCATGTGCTACGAGGCAACTGTATTCTGAAGGGCAGCACGGGCACGGAGAGCGATGACTTCAGTCAAGTCACAACGAGAGTCTGCTGCTGGAATCTGATGGACACCATTCACGCCGCATTCACGCCGAACTGGGAGTCGGTGAGTCGGTGAATTCGCCAATCGCAAATCGCAACGAGGTTTCAGATCTGCA

Full Affymetrix probeset data:

Annotations for 1640795_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720