FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640797_at:

>probe:Drosophila_2:1640797_at:575:563; Interrogation_Position=326; Antisense; GGAAGAAGCTCAGCACCCAGGAGAT
>probe:Drosophila_2:1640797_at:270:517; Interrogation_Position=414; Antisense; GTGGAAGCTCCACCTGGGCGTTTCA
>probe:Drosophila_2:1640797_at:650:529; Interrogation_Position=464; Antisense; GGGTGGCCGTACTGATGAACATCTT
>probe:Drosophila_2:1640797_at:103:717; Interrogation_Position=487; Antisense; TTCGTGTACGATGAGCTGCCCGTTA
>probe:Drosophila_2:1640797_at:246:337; Interrogation_Position=501; Antisense; GCTGCCCGTTACCTTCGATGAGGAG
>probe:Drosophila_2:1640797_at:465:617; Interrogation_Position=542; Antisense; TGCAGCGCATCATCGACCTGGAAAT
>probe:Drosophila_2:1640797_at:550:127; Interrogation_Position=577; Antisense; ACCGGATTGACCTCCAAGTGGGACT
>probe:Drosophila_2:1640797_at:616:377; Interrogation_Position=621; Antisense; GAACTAAGTGCGCTGTCGTTAAATA
>probe:Drosophila_2:1640797_at:12:241; Interrogation_Position=642; Antisense; AATAATTCCGCGATTGTGTGTGATT
>probe:Drosophila_2:1640797_at:525:217; Interrogation_Position=667; Antisense; AAGTTAGCCGACGTCTATGTGTATT
>probe:Drosophila_2:1640797_at:624:65; Interrogation_Position=723; Antisense; ATGGCTGCTGCCTAAATCAATCGAT
>probe:Drosophila_2:1640797_at:541:33; Interrogation_Position=738; Antisense; ATCAATCGATCTTGGGTCAGTCATC
>probe:Drosophila_2:1640797_at:152:531; Interrogation_Position=751; Antisense; GGGTCAGTCATCAGTTTCTGCTAGG
>probe:Drosophila_2:1640797_at:60:127; Interrogation_Position=778; Antisense; ACCAGCCTCAATGATCCGTTTTAAG

Paste this into a BLAST search page for me
GGAAGAAGCTCAGCACCCAGGAGATGTGGAAGCTCCACCTGGGCGTTTCAGGGTGGCCGTACTGATGAACATCTTTTCGTGTACGATGAGCTGCCCGTTAGCTGCCCGTTACCTTCGATGAGGAGTGCAGCGCATCATCGACCTGGAAATACCGGATTGACCTCCAAGTGGGACTGAACTAAGTGCGCTGTCGTTAAATAAATAATTCCGCGATTGTGTGTGATTAAGTTAGCCGACGTCTATGTGTATTATGGCTGCTGCCTAAATCAATCGATATCAATCGATCTTGGGTCAGTCATCGGGTCAGTCATCAGTTTCTGCTAGGACCAGCCTCAATGATCCGTTTTAAG

Full Affymetrix probeset data:

Annotations for 1640797_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720