FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640799_at:

>probe:Drosophila_2:1640799_at:10:173; Interrogation_Position=3450; Antisense; AACAGCAAGCTATTTGGGAAACGAA
>probe:Drosophila_2:1640799_at:664:459; Interrogation_Position=3477; Antisense; GATTATCAGATCACTTTATTCAAAA
>probe:Drosophila_2:1640799_at:452:25; Interrogation_Position=3549; Antisense; ATCAGCCTACAAGATAATCCCTTTG
>probe:Drosophila_2:1640799_at:65:451; Interrogation_Position=3561; Antisense; GATAATCCCTTTGTACTTTACTCTT
>probe:Drosophila_2:1640799_at:148:15; Interrogation_Position=3598; Antisense; ATTACATCTTTCTTGGGCTGTGCGC
>probe:Drosophila_2:1640799_at:682:333; Interrogation_Position=3614; Antisense; GCTGTGCGCTGCTATGTGAAGAAAG
>probe:Drosophila_2:1640799_at:317:345; Interrogation_Position=3638; Antisense; GCATGCGGTTTATTATTACTTCGTG
>probe:Drosophila_2:1640799_at:320:423; Interrogation_Position=3662; Antisense; GAGAACGAGAACTGATCTGGCTGAT
>probe:Drosophila_2:1640799_at:226:41; Interrogation_Position=3676; Antisense; ATCTGGCTGATCTGGAAATAGTGTA
>probe:Drosophila_2:1640799_at:243:675; Interrogation_Position=3694; Antisense; TAGTGTAGCGTACGTTTCTAAACAT
>probe:Drosophila_2:1640799_at:357:185; Interrogation_Position=3748; Antisense; AAGATTTCTTTTGTACAGTTTGACA
>probe:Drosophila_2:1640799_at:104:59; Interrogation_Position=3783; Antisense; ATGTTATGCTATTCACATTGTAGTG
>probe:Drosophila_2:1640799_at:514:363; Interrogation_Position=3808; Antisense; GAATTCGATTGTATCCGCTTAGACA
>probe:Drosophila_2:1640799_at:695:483; Interrogation_Position=3818; Antisense; GTATCCGCTTAGACAGAAAACGCAA

Paste this into a BLAST search page for me
AACAGCAAGCTATTTGGGAAACGAAGATTATCAGATCACTTTATTCAAAAATCAGCCTACAAGATAATCCCTTTGGATAATCCCTTTGTACTTTACTCTTATTACATCTTTCTTGGGCTGTGCGCGCTGTGCGCTGCTATGTGAAGAAAGGCATGCGGTTTATTATTACTTCGTGGAGAACGAGAACTGATCTGGCTGATATCTGGCTGATCTGGAAATAGTGTATAGTGTAGCGTACGTTTCTAAACATAAGATTTCTTTTGTACAGTTTGACAATGTTATGCTATTCACATTGTAGTGGAATTCGATTGTATCCGCTTAGACAGTATCCGCTTAGACAGAAAACGCAA

Full Affymetrix probeset data:

Annotations for 1640799_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720