Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640800_at:

>probe:Drosophila_2:1640800_at:315:133; Interrogation_Position=1002; Antisense; ACGCGCCCGCGTTTTTGAGGCCAAT
>probe:Drosophila_2:1640800_at:162:95; Interrogation_Position=1037; Antisense; AGATTCTGGCCGACACCTGGGAGCA
>probe:Drosophila_2:1640800_at:640:569; Interrogation_Position=1066; Antisense; GGCTACCCACTGCACATTAATTTGG
>probe:Drosophila_2:1640800_at:640:13; Interrogation_Position=1081; Antisense; ATTAATTTGGCTGTGCCGACACCCA
>probe:Drosophila_2:1640800_at:555:131; Interrogation_Position=1105; Antisense; ACCGTCCCAAAACCGAGGCAGATGT
>probe:Drosophila_2:1640800_at:677:95; Interrogation_Position=1124; Antisense; AGATGTCCGATCTGCTCAGTCGGGT
>probe:Drosophila_2:1640800_at:491:715; Interrogation_Position=1166; Antisense; TTCTGTCAGACTTGTACGAGGCGCA
>probe:Drosophila_2:1640800_at:590:87; Interrogation_Position=770; Antisense; AGTCGCGGAGGCACACTCTGCAACA
>probe:Drosophila_2:1640800_at:222:359; Interrogation_Position=789; Antisense; GCAACACGGCATCGATTACAACATG
>probe:Drosophila_2:1640800_at:364:261; Interrogation_Position=841; Antisense; CAGCGGGAACTGCTTCTTTTCGGAC
>probe:Drosophila_2:1640800_at:67:699; Interrogation_Position=854; Antisense; TTCTTTTCGGACTCGATGGCGTGGA
>probe:Drosophila_2:1640800_at:309:607; Interrogation_Position=899; Antisense; TGATGCAGGTGCTCAATGTACAGGA
>probe:Drosophila_2:1640800_at:101:415; Interrogation_Position=922; Antisense; GAGCAGATAAAGTATTTCGGCCGTT
>probe:Drosophila_2:1640800_at:63:201; Interrogation_Position=951; Antisense; AACCCGATTTGATCAGTGGTCTGAA

Paste this into a BLAST search page for me
ACGCGCCCGCGTTTTTGAGGCCAATAGATTCTGGCCGACACCTGGGAGCAGGCTACCCACTGCACATTAATTTGGATTAATTTGGCTGTGCCGACACCCAACCGTCCCAAAACCGAGGCAGATGTAGATGTCCGATCTGCTCAGTCGGGTTTCTGTCAGACTTGTACGAGGCGCAAGTCGCGGAGGCACACTCTGCAACAGCAACACGGCATCGATTACAACATGCAGCGGGAACTGCTTCTTTTCGGACTTCTTTTCGGACTCGATGGCGTGGATGATGCAGGTGCTCAATGTACAGGAGAGCAGATAAAGTATTTCGGCCGTTAACCCGATTTGATCAGTGGTCTGAA

Full Affymetrix probeset data:

Annotations for 1640800_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime