FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640802_at:

>probe:Drosophila_2:1640802_at:730:249; Interrogation_Position=129; Antisense; CAATGCTCAGGATCCCGTTGCGGAG
>probe:Drosophila_2:1640802_at:258:555; Interrogation_Position=150; Antisense; GGAGCCATTTGATCCCGTGAGGAGC
>probe:Drosophila_2:1640802_at:391:727; Interrogation_Position=17; Antisense; TTGTGTTCCCATTCAAGAATCGCCC
>probe:Drosophila_2:1640802_at:34:215; Interrogation_Position=181; Antisense; AAGAGGACGCGCACCAAGCTGACGG
>probe:Drosophila_2:1640802_at:226:499; Interrogation_Position=206; Antisense; GTCTGCTGCACCACTTCAACATAGT
>probe:Drosophila_2:1640802_at:60:549; Interrogation_Position=243; Antisense; GGATGGGTCCCGATGCAGACGCAAT
>probe:Drosophila_2:1640802_at:721:697; Interrogation_Position=271; Antisense; TTTCACCTCGTGGTTCCGATGGACA
>probe:Drosophila_2:1640802_at:445:67; Interrogation_Position=329; Antisense; ATGGCATCCAGGGTTGGTCCGATAT
>probe:Drosophila_2:1640802_at:628:503; Interrogation_Position=345; Antisense; GTCCGATATCGAGGTCTCCGACGAA
>probe:Drosophila_2:1640802_at:626:625; Interrogation_Position=361; Antisense; TCCGACGAACCATCCGAAATGCAGG
>probe:Drosophila_2:1640802_at:6:549; Interrogation_Position=384; Antisense; GGAGGACCGACCAACAGAACTTGCA
>probe:Drosophila_2:1640802_at:427:47; Interrogation_Position=42; Antisense; ATCCAGGCAGTTACCGCTGTACGAA
>probe:Drosophila_2:1640802_at:104:133; Interrogation_Position=54; Antisense; ACCGCTGTACGAACTGCCTGGGAGG
>probe:Drosophila_2:1640802_at:320:597; Interrogation_Position=84; Antisense; TGTCCTATTGGTGCGCCACTATAAG

Paste this into a BLAST search page for me
CAATGCTCAGGATCCCGTTGCGGAGGGAGCCATTTGATCCCGTGAGGAGCTTGTGTTCCCATTCAAGAATCGCCCAAGAGGACGCGCACCAAGCTGACGGGTCTGCTGCACCACTTCAACATAGTGGATGGGTCCCGATGCAGACGCAATTTTCACCTCGTGGTTCCGATGGACAATGGCATCCAGGGTTGGTCCGATATGTCCGATATCGAGGTCTCCGACGAATCCGACGAACCATCCGAAATGCAGGGGAGGACCGACCAACAGAACTTGCAATCCAGGCAGTTACCGCTGTACGAAACCGCTGTACGAACTGCCTGGGAGGTGTCCTATTGGTGCGCCACTATAAG

Full Affymetrix probeset data:

Annotations for 1640802_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720