FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640803_at:

>probe:Drosophila_2:1640803_at:126:631; Interrogation_Position=104; Antisense; TCCGGCGCTGGCTGCCTGGATACAG
>probe:Drosophila_2:1640803_at:558:589; Interrogation_Position=120; Antisense; TGGATACAGCTTCATTCGCGGCAAG
>probe:Drosophila_2:1640803_at:576:563; Interrogation_Position=139; Antisense; GGCAAGCGTCTCTCGACATCGGAAA
>probe:Drosophila_2:1640803_at:488:559; Interrogation_Position=159; Antisense; GGAAACCTCGATCGTGCACGGCTGC
>probe:Drosophila_2:1640803_at:713:689; Interrogation_Position=21; Antisense; TTTGGCTAACGAGTACACCGGCAGT
>probe:Drosophila_2:1640803_at:465:75; Interrogation_Position=236; Antisense; AGGAGGTGTACCTGGACACCGGCAT
>probe:Drosophila_2:1640803_at:201:289; Interrogation_Position=255; Antisense; CGGCATCGCCAAGTCGGAGTTCTGC
>probe:Drosophila_2:1640803_at:574:639; Interrogation_Position=268; Antisense; TCGGAGTTCTGCGTCCACCTGGAGA
>probe:Drosophila_2:1640803_at:567:131; Interrogation_Position=284; Antisense; ACCTGGAGACCTTGCTGCGCAACAA
>probe:Drosophila_2:1640803_at:149:363; Interrogation_Position=328; Antisense; GAATTGGCCCTGGAACATCAGGAGA
>probe:Drosophila_2:1640803_at:288:189; Interrogation_Position=341; Antisense; AACATCAGGAGAGAAGCCGCGAGAT
>probe:Drosophila_2:1640803_at:576:559; Interrogation_Position=378; Antisense; GGAACGGCAGCTCAATCAACAAGTT
>probe:Drosophila_2:1640803_at:260:587; Interrogation_Position=57; Antisense; TGGAGAAGCCTCCAAGCTCGGACTC
>probe:Drosophila_2:1640803_at:217:631; Interrogation_Position=80; Antisense; TCCTGGCCAGGGTGGACCGTCTGCT

Paste this into a BLAST search page for me
TCCGGCGCTGGCTGCCTGGATACAGTGGATACAGCTTCATTCGCGGCAAGGGCAAGCGTCTCTCGACATCGGAAAGGAAACCTCGATCGTGCACGGCTGCTTTGGCTAACGAGTACACCGGCAGTAGGAGGTGTACCTGGACACCGGCATCGGCATCGCCAAGTCGGAGTTCTGCTCGGAGTTCTGCGTCCACCTGGAGAACCTGGAGACCTTGCTGCGCAACAAGAATTGGCCCTGGAACATCAGGAGAAACATCAGGAGAGAAGCCGCGAGATGGAACGGCAGCTCAATCAACAAGTTTGGAGAAGCCTCCAAGCTCGGACTCTCCTGGCCAGGGTGGACCGTCTGCT

Full Affymetrix probeset data:

Annotations for 1640803_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720