Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640806_at:

>probe:Drosophila_2:1640806_at:706:613; Interrogation_Position=1387; Antisense; TGAAGCTCCAGTGTCCAGTACTCCA
>probe:Drosophila_2:1640806_at:102:505; Interrogation_Position=1399; Antisense; GTCCAGTACTCCAGAAAGCACTACC
>probe:Drosophila_2:1640806_at:133:263; Interrogation_Position=1410; Antisense; CAGAAAGCACTACCGAAGCCGCTTC
>probe:Drosophila_2:1640806_at:311:379; Interrogation_Position=1424; Antisense; GAAGCCGCTTCCACTACCGAGCGTT
>probe:Drosophila_2:1640806_at:560:303; Interrogation_Position=1440; Antisense; CCGAGCGTTCCCCTGAGGAAGATAT
>probe:Drosophila_2:1640806_at:565:469; Interrogation_Position=1446; Antisense; GTTCCCCTGAGGAAGATATCGACAG
>probe:Drosophila_2:1640806_at:217:23; Interrogation_Position=1461; Antisense; ATATCGACAGATCTGGGCGTCTCGG
>probe:Drosophila_2:1640806_at:244:155; Interrogation_Position=1467; Antisense; ACAGATCTGGGCGTCTCGGTCAGAG
>probe:Drosophila_2:1640806_at:628:287; Interrogation_Position=1482; Antisense; TCGGTCAGAGGAGAACTTGGAACCT
>probe:Drosophila_2:1640806_at:555:369; Interrogation_Position=1494; Antisense; GAACTTGGAACCTGTTTAAGCGCTT
>probe:Drosophila_2:1640806_at:248:381; Interrogation_Position=1501; Antisense; GAACCTGTTTAAGCGCTTCTTCTAA
>probe:Drosophila_2:1640806_at:605:659; Interrogation_Position=1510; Antisense; TAAGCGCTTCTTCTAAGCGTGAGAA
>probe:Drosophila_2:1640806_at:703:191; Interrogation_Position=1534; Antisense; AACTTTGTATTATTTATTGCATTCA
>probe:Drosophila_2:1640806_at:369:363; Interrogation_Position=1563; Antisense; GAAAATTTAGCTACGTATAAAGCGT

Paste this into a BLAST search page for me
TGAAGCTCCAGTGTCCAGTACTCCAGTCCAGTACTCCAGAAAGCACTACCCAGAAAGCACTACCGAAGCCGCTTCGAAGCCGCTTCCACTACCGAGCGTTCCGAGCGTTCCCCTGAGGAAGATATGTTCCCCTGAGGAAGATATCGACAGATATCGACAGATCTGGGCGTCTCGGACAGATCTGGGCGTCTCGGTCAGAGTCGGTCAGAGGAGAACTTGGAACCTGAACTTGGAACCTGTTTAAGCGCTTGAACCTGTTTAAGCGCTTCTTCTAATAAGCGCTTCTTCTAAGCGTGAGAAAACTTTGTATTATTTATTGCATTCAGAAAATTTAGCTACGTATAAAGCGT

Full Affymetrix probeset data:

Annotations for 1640806_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime