FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640808_at:

>probe:Drosophila_2:1640808_at:337:587; Interrogation_Position=1748; Antisense; TGGAGGCGGCTGTCGATAATCGAAA
>probe:Drosophila_2:1640808_at:555:717; Interrogation_Position=1821; Antisense; TTCCGGCAATAAAAGCGTTCAGTCA
>probe:Drosophila_2:1640808_at:296:87; Interrogation_Position=1841; Antisense; AGTCAGCCGATGAAGACCTGCCTAA
>probe:Drosophila_2:1640808_at:518:279; Interrogation_Position=1862; Antisense; CTAAGGACCTCTTATCCCTGGAAGA
>probe:Drosophila_2:1640808_at:599:11; Interrogation_Position=1932; Antisense; ATTCTGTGCAGACCAATTTCAATTG
>probe:Drosophila_2:1640808_at:303:5; Interrogation_Position=1953; Antisense; ATTGTTCGACATGAGTGCGTTTCAC
>probe:Drosophila_2:1640808_at:101:477; Interrogation_Position=1971; Antisense; GTTTCACAATTCGTCGCTGGGCGAG
>probe:Drosophila_2:1640808_at:254:97; Interrogation_Position=1994; Antisense; AGATCGTGGGCTACGGAATCAGCGA
>probe:Drosophila_2:1640808_at:502:115; Interrogation_Position=2027; Antisense; AGCTAAATGTGGTGGACTGTCCTTA
>probe:Drosophila_2:1640808_at:186:405; Interrogation_Position=2041; Antisense; GACTGTCCTTACGATGAAACGCGCA
>probe:Drosophila_2:1640808_at:52:135; Interrogation_Position=2059; Antisense; ACGCGCATTCGCAACCTTTGGAAAA
>probe:Drosophila_2:1640808_at:715:187; Interrogation_Position=2111; Antisense; AACAGCATAGCAAGTATCCGGTAAG
>probe:Drosophila_2:1640808_at:260:385; Interrogation_Position=2144; Antisense; GAACTAGCATACGAGCGGTCAAGAA
>probe:Drosophila_2:1640808_at:507:537; Interrogation_Position=2160; Antisense; GGTCAAGAAGAGAGTCGCCTTTCAA

Paste this into a BLAST search page for me
TGGAGGCGGCTGTCGATAATCGAAATTCCGGCAATAAAAGCGTTCAGTCAAGTCAGCCGATGAAGACCTGCCTAACTAAGGACCTCTTATCCCTGGAAGAATTCTGTGCAGACCAATTTCAATTGATTGTTCGACATGAGTGCGTTTCACGTTTCACAATTCGTCGCTGGGCGAGAGATCGTGGGCTACGGAATCAGCGAAGCTAAATGTGGTGGACTGTCCTTAGACTGTCCTTACGATGAAACGCGCAACGCGCATTCGCAACCTTTGGAAAAAACAGCATAGCAAGTATCCGGTAAGGAACTAGCATACGAGCGGTCAAGAAGGTCAAGAAGAGAGTCGCCTTTCAA

Full Affymetrix probeset data:

Annotations for 1640808_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720