Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640809_at:

>probe:Drosophila_2:1640809_at:656:671; Interrogation_Position=5324; Antisense; TACGCGGAGCGCTATCGTAAGACGC
>probe:Drosophila_2:1640809_at:488:585; Interrogation_Position=5376; Antisense; TGGAACGGATCACCAGCATCTCGTA
>probe:Drosophila_2:1640809_at:46:323; Interrogation_Position=5432; Antisense; GCCCACGTCAGCTATATCAAGAAGT
>probe:Drosophila_2:1640809_at:126:625; Interrogation_Position=5472; Antisense; TGCGCTTTGGCACCAAGGAGTACCT
>probe:Drosophila_2:1640809_at:199:429; Interrogation_Position=5489; Antisense; GAGTACCTGGAGATCGACTACGAGC
>probe:Drosophila_2:1640809_at:166:525; Interrogation_Position=5535; Antisense; GGGCGGCCAGCTACAGCATATGGAA
>probe:Drosophila_2:1640809_at:447:533; Interrogation_Position=5563; Antisense; GGTGTAGACACCAGCAGAACAGCAA
>probe:Drosophila_2:1640809_at:437:517; Interrogation_Position=5642; Antisense; GTGTGTCCAGCCAACTTTGAGTGCA
>probe:Drosophila_2:1640809_at:681:503; Interrogation_Position=5678; Antisense; GTCCGCCATGCGAGGTAATTTTTTA
>probe:Drosophila_2:1640809_at:474:711; Interrogation_Position=5700; Antisense; TTAAGGATCTCAACTCGACATTCAG
>probe:Drosophila_2:1640809_at:106:433; Interrogation_Position=5737; Antisense; GAGTGATTCGTCCTAGTCGGTCTAT
>probe:Drosophila_2:1640809_at:654:85; Interrogation_Position=5786; Antisense; AGTAGCCTAGTCTTATGTGTATCCT
>probe:Drosophila_2:1640809_at:390:679; Interrogation_Position=5817; Antisense; TAGTGTAACTTATTCCAGGCCTTCG
>probe:Drosophila_2:1640809_at:658:267; Interrogation_Position=5832; Antisense; CAGGCCTTCGTTTACATCTAAGTAT

Paste this into a BLAST search page for me
TACGCGGAGCGCTATCGTAAGACGCTGGAACGGATCACCAGCATCTCGTAGCCCACGTCAGCTATATCAAGAAGTTGCGCTTTGGCACCAAGGAGTACCTGAGTACCTGGAGATCGACTACGAGCGGGCGGCCAGCTACAGCATATGGAAGGTGTAGACACCAGCAGAACAGCAAGTGTGTCCAGCCAACTTTGAGTGCAGTCCGCCATGCGAGGTAATTTTTTATTAAGGATCTCAACTCGACATTCAGGAGTGATTCGTCCTAGTCGGTCTATAGTAGCCTAGTCTTATGTGTATCCTTAGTGTAACTTATTCCAGGCCTTCGCAGGCCTTCGTTTACATCTAAGTAT

Full Affymetrix probeset data:

Annotations for 1640809_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime