FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640810_at:

>probe:Drosophila_2:1640810_at:353:721; Interrogation_Position=1000; Antisense; TTCCTCTGCCTCATATACATCACAA
>probe:Drosophila_2:1640810_at:426:515; Interrogation_Position=1028; Antisense; GTGTGCTTTCGAGCCAGGGAATCCA
>probe:Drosophila_2:1640810_at:21:83; Interrogation_Position=1043; Antisense; AGGGAATCCACTGGCTCCTGGAGTG
>probe:Drosophila_2:1640810_at:352:691; Interrogation_Position=1075; Antisense; TTTCTCCACACAGAGTTGGCCCTGG
>probe:Drosophila_2:1640810_at:680:581; Interrogation_Position=1097; Antisense; TGGCCGCAGGATTCATTCTGCAACT
>probe:Drosophila_2:1640810_at:571:253; Interrogation_Position=1117; Antisense; CAACTGTGCGTTATGGAGGGCTCCA
>probe:Drosophila_2:1640810_at:576:81; Interrogation_Position=1133; Antisense; AGGGCTCCAAATACGAGTCCTACGC
>probe:Drosophila_2:1640810_at:525:287; Interrogation_Position=1160; Antisense; CGGACACATGGATTGCCCTGATAAT
>probe:Drosophila_2:1640810_at:181:515; Interrogation_Position=1190; Antisense; GTGTAATCACTCAGGGACTCACTGC
>probe:Drosophila_2:1640810_at:649:113; Interrogation_Position=1399; Antisense; AGCAGGGTCTTTCAGCAGTATCCGA
>probe:Drosophila_2:1640810_at:31:553; Interrogation_Position=874; Antisense; GGAGCACTGCTCCTGATGAGATACA
>probe:Drosophila_2:1640810_at:15:599; Interrogation_Position=911; Antisense; TGTACCTACTCTTCGGACTTATTCA
>probe:Drosophila_2:1640810_at:481:455; Interrogation_Position=936; Antisense; GATAACTTCGATTGTGGCTCTGCTG
>probe:Drosophila_2:1640810_at:363:105; Interrogation_Position=977; Antisense; AGCAGTCGGAACACTGTTTCCTGTT

Paste this into a BLAST search page for me
TTCCTCTGCCTCATATACATCACAAGTGTGCTTTCGAGCCAGGGAATCCAAGGGAATCCACTGGCTCCTGGAGTGTTTCTCCACACAGAGTTGGCCCTGGTGGCCGCAGGATTCATTCTGCAACTCAACTGTGCGTTATGGAGGGCTCCAAGGGCTCCAAATACGAGTCCTACGCCGGACACATGGATTGCCCTGATAATGTGTAATCACTCAGGGACTCACTGCAGCAGGGTCTTTCAGCAGTATCCGAGGAGCACTGCTCCTGATGAGATACATGTACCTACTCTTCGGACTTATTCAGATAACTTCGATTGTGGCTCTGCTGAGCAGTCGGAACACTGTTTCCTGTT

Full Affymetrix probeset data:

Annotations for 1640810_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720