FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640812_at:

>probe:Drosophila_2:1640812_at:407:23; Interrogation_Position=1138; Antisense; ATATCATACAAATTCTTCGCCCTGC
>probe:Drosophila_2:1640812_at:675:267; Interrogation_Position=587; Antisense; CAGGATACACATCTGCAGCTGGTCA
>probe:Drosophila_2:1640812_at:139:245; Interrogation_Position=612; Antisense; AATTTCAACCGATGTCTTGCTCTGC
>probe:Drosophila_2:1640812_at:225:523; Interrogation_Position=640; Antisense; GTGGCCACTCAGTTGGTAATGCACT
>probe:Drosophila_2:1640812_at:86:657; Interrogation_Position=656; Antisense; TAATGCACTTCGACTTTCTCTCAAA
>probe:Drosophila_2:1640812_at:540:225; Interrogation_Position=718; Antisense; AAGGACTCCCGATTTCTGGTGGACA
>probe:Drosophila_2:1640812_at:61:29; Interrogation_Position=763; Antisense; ATACTCCGCCTTTCAGATGCAGTGA
>probe:Drosophila_2:1640812_at:192:585; Interrogation_Position=798; Antisense; TGGAATTCCACTACTACTCAACTTC
>probe:Drosophila_2:1640812_at:656:661; Interrogation_Position=812; Antisense; TACTCAACTTCATGGTATCCTCGTT
>probe:Drosophila_2:1640812_at:504:55; Interrogation_Position=862; Antisense; ATGACTGTTGGAGTTCCGCCGGATA
>probe:Drosophila_2:1640812_at:412:719; Interrogation_Position=907; Antisense; TTCCTTGTCTCTTCGATGAGTCAGG
>probe:Drosophila_2:1640812_at:600:495; Interrogation_Position=944; Antisense; GTCACTATGGTCAACTGGTGGCCGA
>probe:Drosophila_2:1640812_at:310:341; Interrogation_Position=970; Antisense; GCTAGCTACGGATTTTCGGTTGCCA
>probe:Drosophila_2:1640812_at:464:639; Interrogation_Position=985; Antisense; TCGGTTGCCACCTACAATCAGAAGT

Paste this into a BLAST search page for me
ATATCATACAAATTCTTCGCCCTGCCAGGATACACATCTGCAGCTGGTCAAATTTCAACCGATGTCTTGCTCTGCGTGGCCACTCAGTTGGTAATGCACTTAATGCACTTCGACTTTCTCTCAAAAAGGACTCCCGATTTCTGGTGGACAATACTCCGCCTTTCAGATGCAGTGATGGAATTCCACTACTACTCAACTTCTACTCAACTTCATGGTATCCTCGTTATGACTGTTGGAGTTCCGCCGGATATTCCTTGTCTCTTCGATGAGTCAGGGTCACTATGGTCAACTGGTGGCCGAGCTAGCTACGGATTTTCGGTTGCCATCGGTTGCCACCTACAATCAGAAGT

Full Affymetrix probeset data:

Annotations for 1640812_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720