FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640817_at:

>probe:Drosophila_2:1640817_at:407:371; Interrogation_Position=3685; Antisense; GAACCTACGGTCACCTGGCTGAAGG
>probe:Drosophila_2:1640817_at:355:563; Interrogation_Position=3733; Antisense; GGAATTTCCGAGCATCGCTTGCTAG
>probe:Drosophila_2:1640817_at:35:227; Interrogation_Position=3761; Antisense; AAGGCAACTCCTACAGGCTGATCAT
>probe:Drosophila_2:1640817_at:661:393; Interrogation_Position=3812; Antisense; GAAAGTACATGGTTCGCGCCACAAA
>probe:Drosophila_2:1640817_at:512:69; Interrogation_Position=3848; Antisense; AGGCCAAGAGCATTGCCGACTGTGC
>probe:Drosophila_2:1640817_at:642:519; Interrogation_Position=3940; Antisense; GTGGCTCCGGCCAGCGAATTCAAAA
>probe:Drosophila_2:1640817_at:61:517; Interrogation_Position=3974; Antisense; GTGTGCATGTGCTCAATATCTAACC
>probe:Drosophila_2:1640817_at:65:659; Interrogation_Position=3994; Antisense; TAACCACCGACTACTATGCATTATC
>probe:Drosophila_2:1640817_at:34:665; Interrogation_Position=4032; Antisense; TACAACTCTTTCAATCTACTCCGAT
>probe:Drosophila_2:1640817_at:28:279; Interrogation_Position=4065; Antisense; CTATCTTTCTTTTCGACTCTGTTAA
>probe:Drosophila_2:1640817_at:125:365; Interrogation_Position=4135; Antisense; GAATTTTCTCCTCTCATGATGTCAA
>probe:Drosophila_2:1640817_at:113:607; Interrogation_Position=4151; Antisense; TGATGTCAACGTCGTTCGTTCTTTC
>probe:Drosophila_2:1640817_at:435:277; Interrogation_Position=4182; Antisense; CTTTGCTCATTCCACGGGTTATCAA
>probe:Drosophila_2:1640817_at:348:531; Interrogation_Position=4197; Antisense; GGGTTATCAACACTCCATCCTGAAA

Paste this into a BLAST search page for me
GAACCTACGGTCACCTGGCTGAAGGGGAATTTCCGAGCATCGCTTGCTAGAAGGCAACTCCTACAGGCTGATCATGAAAGTACATGGTTCGCGCCACAAAAGGCCAAGAGCATTGCCGACTGTGCGTGGCTCCGGCCAGCGAATTCAAAAGTGTGCATGTGCTCAATATCTAACCTAACCACCGACTACTATGCATTATCTACAACTCTTTCAATCTACTCCGATCTATCTTTCTTTTCGACTCTGTTAAGAATTTTCTCCTCTCATGATGTCAATGATGTCAACGTCGTTCGTTCTTTCCTTTGCTCATTCCACGGGTTATCAAGGGTTATCAACACTCCATCCTGAAA

Full Affymetrix probeset data:

Annotations for 1640817_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720