FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640818_at:

>probe:Drosophila_2:1640818_at:279:395; Interrogation_Position=1856; Antisense; GAAATCGCAGCCGTGGTCACTGAGC
>probe:Drosophila_2:1640818_at:44:539; Interrogation_Position=1870; Antisense; GGTCACTGAGCGTCAGCGGTAGCAA
>probe:Drosophila_2:1640818_at:334:611; Interrogation_Position=1909; Antisense; TGCGAAAGCTGGTGAACCTGCCGGA
>probe:Drosophila_2:1640818_at:176:97; Interrogation_Position=1951; Antisense; AGATAGCCTGGCAGGTGGCCGAAAT
>probe:Drosophila_2:1640818_at:525:503; Interrogation_Position=1980; Antisense; GTCCGGGATGTTACGAGTGTCACTC
>probe:Drosophila_2:1640818_at:457:495; Interrogation_Position=1998; Antisense; GTCACTCTTAGTGGCAAGACTCCTC
>probe:Drosophila_2:1640818_at:260:579; Interrogation_Position=2027; Antisense; GGCCTGATGTGCTTTACCATTACGG
>probe:Drosophila_2:1640818_at:149:707; Interrogation_Position=2087; Antisense; TTACTCTTTTTTGCGAGAATCTCCA
>probe:Drosophila_2:1640818_at:162:423; Interrogation_Position=2101; Antisense; GAGAATCTCCACGACATGTGCACAA
>probe:Drosophila_2:1640818_at:322:373; Interrogation_Position=2130; Antisense; GAAGTCGCAACAGAAGCTCTCTCTA
>probe:Drosophila_2:1640818_at:332:277; Interrogation_Position=2152; Antisense; CTAGTACCCTCTCCTTATGTACAAA
>probe:Drosophila_2:1640818_at:14:15; Interrogation_Position=2247; Antisense; ATTAACTAAACTATCGCTCGCTCAT
>probe:Drosophila_2:1640818_at:123:635; Interrogation_Position=2260; Antisense; TCGCTCGCTCATTTGTTATTTACAG
>probe:Drosophila_2:1640818_at:664:345; Interrogation_Position=2389; Antisense; GCATACTGATGATACACTACCAAGG

Paste this into a BLAST search page for me
GAAATCGCAGCCGTGGTCACTGAGCGGTCACTGAGCGTCAGCGGTAGCAATGCGAAAGCTGGTGAACCTGCCGGAAGATAGCCTGGCAGGTGGCCGAAATGTCCGGGATGTTACGAGTGTCACTCGTCACTCTTAGTGGCAAGACTCCTCGGCCTGATGTGCTTTACCATTACGGTTACTCTTTTTTGCGAGAATCTCCAGAGAATCTCCACGACATGTGCACAAGAAGTCGCAACAGAAGCTCTCTCTACTAGTACCCTCTCCTTATGTACAAAATTAACTAAACTATCGCTCGCTCATTCGCTCGCTCATTTGTTATTTACAGGCATACTGATGATACACTACCAAGG

Full Affymetrix probeset data:

Annotations for 1640818_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720