FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640819_at:

>probe:Drosophila_2:1640819_at:300:639; Interrogation_Position=342; Antisense; TCGTCGCTCATTCAACCAGAACAAT
>probe:Drosophila_2:1640819_at:263:263; Interrogation_Position=358; Antisense; CAGAACAATTTGGTCGACGGAAACG
>probe:Drosophila_2:1640819_at:115:297; Interrogation_Position=390; Antisense; CGACGATGAGGAGTTTGACCAGGAT
>probe:Drosophila_2:1640819_at:707:219; Interrogation_Position=449; Antisense; AAGTGCAGGAGGACGACCAAGATGA
>probe:Drosophila_2:1640819_at:490:611; Interrogation_Position=474; Antisense; TGACGATAACGAGGACGACGGCTTC
>probe:Drosophila_2:1640819_at:390:75; Interrogation_Position=485; Antisense; AGGACGACGGCTTCCAGCTTGTGGC
>probe:Drosophila_2:1640819_at:245:645; Interrogation_Position=538; Antisense; TCTATTCGCCGTCGCAACAGCGCTA
>probe:Drosophila_2:1640819_at:99:189; Interrogation_Position=553; Antisense; AACAGCGCTAGCAGCTCCTACGGAT
>probe:Drosophila_2:1640819_at:652:545; Interrogation_Position=574; Antisense; GGATCGTCCGGCAACAAGAATCTGT
>probe:Drosophila_2:1640819_at:713:39; Interrogation_Position=593; Antisense; ATCTGTCCAACAGCGAATTGATGCG
>probe:Drosophila_2:1640819_at:281:51; Interrogation_Position=613; Antisense; ATGCGCGAAATCGAACTGCGCCGGC
>probe:Drosophila_2:1640819_at:671:193; Interrogation_Position=626; Antisense; AACTGCGCCGGCAGAAGGAACTCAA
>probe:Drosophila_2:1640819_at:254:507; Interrogation_Position=710; Antisense; GTGCCCTAAACAAACGCCGTCGTGC
>probe:Drosophila_2:1640819_at:90:497; Interrogation_Position=830; Antisense; GTCAGCGACGCAACAATCGCCTGAG

Paste this into a BLAST search page for me
TCGTCGCTCATTCAACCAGAACAATCAGAACAATTTGGTCGACGGAAACGCGACGATGAGGAGTTTGACCAGGATAAGTGCAGGAGGACGACCAAGATGATGACGATAACGAGGACGACGGCTTCAGGACGACGGCTTCCAGCTTGTGGCTCTATTCGCCGTCGCAACAGCGCTAAACAGCGCTAGCAGCTCCTACGGATGGATCGTCCGGCAACAAGAATCTGTATCTGTCCAACAGCGAATTGATGCGATGCGCGAAATCGAACTGCGCCGGCAACTGCGCCGGCAGAAGGAACTCAAGTGCCCTAAACAAACGCCGTCGTGCGTCAGCGACGCAACAATCGCCTGAG

Full Affymetrix probeset data:

Annotations for 1640819_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720