Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640823_at:

>probe:Drosophila_2:1640823_at:529:627; Interrogation_Position=1408; Antisense; TGCCACAATGCATAGCAGCCACTTG
>probe:Drosophila_2:1640823_at:658:603; Interrogation_Position=1476; Antisense; TGTTGCCCAGCCATTTGAAGTGCGG
>probe:Drosophila_2:1640823_at:320:615; Interrogation_Position=1491; Antisense; TGAAGTGCGGCATGTGCGCCTCGCT
>probe:Drosophila_2:1640823_at:311:317; Interrogation_Position=1523; Antisense; GCCTCCGTTTTCGTGGCAGGAACAA
>probe:Drosophila_2:1640823_at:726:385; Interrogation_Position=1542; Antisense; GAACAAAGTTCTACTTCGACCACCA
>probe:Drosophila_2:1640823_at:576:605; Interrogation_Position=1629; Antisense; TGATCAGCCTGTGCCGCATTCCGAA
>probe:Drosophila_2:1640823_at:449:167; Interrogation_Position=1652; Antisense; AAAGGCCTCTTCTCGAGTTCCAGTG
>probe:Drosophila_2:1640823_at:30:229; Interrogation_Position=1682; Antisense; AATGGCCGAGCAGCGGTTTGCCATA
>probe:Drosophila_2:1640823_at:431:693; Interrogation_Position=1698; Antisense; TTTGCCATAGCCGTGGTGTCAACTC
>probe:Drosophila_2:1640823_at:476:513; Interrogation_Position=1713; Antisense; GTGTCAACTCCTCGTTAGCGGGAAC
>probe:Drosophila_2:1640823_at:570:671; Interrogation_Position=1728; Antisense; TAGCGGGAACCGGAGCTGCACAGTC
>probe:Drosophila_2:1640823_at:56:309; Interrogation_Position=1852; Antisense; CCATATAGCCATATTGCTGCCGGAA
>probe:Drosophila_2:1640823_at:346:155; Interrogation_Position=1876; Antisense; ACAGACGCCGGCGACAATGGGCAAA
>probe:Drosophila_2:1640823_at:66:195; Interrogation_Position=1902; Antisense; AACTGCCGTTGGATGAATCACCGCC

Paste this into a BLAST search page for me
TGCCACAATGCATAGCAGCCACTTGTGTTGCCCAGCCATTTGAAGTGCGGTGAAGTGCGGCATGTGCGCCTCGCTGCCTCCGTTTTCGTGGCAGGAACAAGAACAAAGTTCTACTTCGACCACCATGATCAGCCTGTGCCGCATTCCGAAAAAGGCCTCTTCTCGAGTTCCAGTGAATGGCCGAGCAGCGGTTTGCCATATTTGCCATAGCCGTGGTGTCAACTCGTGTCAACTCCTCGTTAGCGGGAACTAGCGGGAACCGGAGCTGCACAGTCCCATATAGCCATATTGCTGCCGGAAACAGACGCCGGCGACAATGGGCAAAAACTGCCGTTGGATGAATCACCGCC

Full Affymetrix probeset data:

Annotations for 1640823_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime