FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640824_at:

>probe:Drosophila_2:1640824_at:355:185; Interrogation_Position=1050; Antisense; AAGTTGGTTATTGTGGGCTCCTGCC
>probe:Drosophila_2:1640824_at:40:555; Interrogation_Position=1112; Antisense; GGACCTGACAAAGCATCTGTCGCTA
>probe:Drosophila_2:1640824_at:498:367; Interrogation_Position=1160; Antisense; GAATGTCCCTTACGAAGACCTTCTT
>probe:Drosophila_2:1640824_at:484:467; Interrogation_Position=1187; Antisense; GTTGTATCAAACTGCCCACATTGGC
>probe:Drosophila_2:1640824_at:672:727; Interrogation_Position=1237; Antisense; TTGGCATCGGCATCGTCGAGTCCAT
>probe:Drosophila_2:1640824_at:282:431; Interrogation_Position=1254; Antisense; GAGTCCATGGCTGCTGGCCTTATAA
>probe:Drosophila_2:1640824_at:622:531; Interrogation_Position=1298; Antisense; GGGTCCTTTGCTTGACATTGTCGAA
>probe:Drosophila_2:1640824_at:34:403; Interrogation_Position=1311; Antisense; GACATTGTCGAAACTTCCGCGGGAA
>probe:Drosophila_2:1640824_at:580:69; Interrogation_Position=1339; Antisense; AGAACGGATTCCTGGCTACTGACGC
>probe:Drosophila_2:1640824_at:183:341; Interrogation_Position=1353; Antisense; GCTACTGACGCCGTTGAATACGCAG
>probe:Drosophila_2:1640824_at:687:631; Interrogation_Position=1443; Antisense; TCCGTGGAACGGTTTTCTGAGCAAG
>probe:Drosophila_2:1640824_at:626:191; Interrogation_Position=1479; Antisense; AACTTTCTTCGAGCTGTTTCAACGC
>probe:Drosophila_2:1640824_at:489:89; Interrogation_Position=1529; Antisense; AGTACGCCCGCACCTAAATAAATAT
>probe:Drosophila_2:1640824_at:167:335; Interrogation_Position=986; Antisense; GCTGCAAGCCATATACGAGCTCCGA

Paste this into a BLAST search page for me
AAGTTGGTTATTGTGGGCTCCTGCCGGACCTGACAAAGCATCTGTCGCTAGAATGTCCCTTACGAAGACCTTCTTGTTGTATCAAACTGCCCACATTGGCTTGGCATCGGCATCGTCGAGTCCATGAGTCCATGGCTGCTGGCCTTATAAGGGTCCTTTGCTTGACATTGTCGAAGACATTGTCGAAACTTCCGCGGGAAAGAACGGATTCCTGGCTACTGACGCGCTACTGACGCCGTTGAATACGCAGTCCGTGGAACGGTTTTCTGAGCAAGAACTTTCTTCGAGCTGTTTCAACGCAGTACGCCCGCACCTAAATAAATATGCTGCAAGCCATATACGAGCTCCGA

Full Affymetrix probeset data:

Annotations for 1640824_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720