FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640826_at:

>probe:Drosophila_2:1640826_at:298:417; Interrogation_Position=1008; Antisense; GAGCGGATCCTCGACTTTGTGGCCA
>probe:Drosophila_2:1640826_at:518:579; Interrogation_Position=1028; Antisense; GGCCACAAGTGTGCCCATTGCTAAG
>probe:Drosophila_2:1640826_at:186:611; Interrogation_Position=1046; Antisense; TGCTAAGGTGGTTGCCAAACCCCTT
>probe:Drosophila_2:1640826_at:687:663; Interrogation_Position=1070; Antisense; TAAAGATTACATTCCCACGTGGCAA
>probe:Drosophila_2:1640826_at:178:113; Interrogation_Position=1095; Antisense; AGCACTTACTTCTATCTGTGGTCCA
>probe:Drosophila_2:1640826_at:336:519; Interrogation_Position=1112; Antisense; GTGGTCCACTTAGGCATTTCAGGTA
>probe:Drosophila_2:1640826_at:28:487; Interrogation_Position=1134; Antisense; GTAGAGCGTTAGTATTCCCCTAGGC
>probe:Drosophila_2:1640826_at:256:93; Interrogation_Position=1169; Antisense; AGTTACAGGTGTGGACGCATTCGGA
>probe:Drosophila_2:1640826_at:455:583; Interrogation_Position=1311; Antisense; TGGCATTGCCGCTCTTGAGGTGAAA
>probe:Drosophila_2:1640826_at:156:21; Interrogation_Position=865; Antisense; ATTTGTATAGCATTCACCTCTACCG
>probe:Drosophila_2:1640826_at:358:347; Interrogation_Position=893; Antisense; GCATCGCGACCTAATGTCCAAGCAA
>probe:Drosophila_2:1640826_at:386:663; Interrogation_Position=946; Antisense; TAAACATCATGTACTTCCTGGTCCG
>probe:Drosophila_2:1640826_at:359:293; Interrogation_Position=969; Antisense; CGATCGCCGTTCTATGACAGCTTCA
>probe:Drosophila_2:1640826_at:484:399; Interrogation_Position=984; Antisense; GACAGCTTCACCAAATCCAGACTGG

Paste this into a BLAST search page for me
GAGCGGATCCTCGACTTTGTGGCCAGGCCACAAGTGTGCCCATTGCTAAGTGCTAAGGTGGTTGCCAAACCCCTTTAAAGATTACATTCCCACGTGGCAAAGCACTTACTTCTATCTGTGGTCCAGTGGTCCACTTAGGCATTTCAGGTAGTAGAGCGTTAGTATTCCCCTAGGCAGTTACAGGTGTGGACGCATTCGGATGGCATTGCCGCTCTTGAGGTGAAAATTTGTATAGCATTCACCTCTACCGGCATCGCGACCTAATGTCCAAGCAATAAACATCATGTACTTCCTGGTCCGCGATCGCCGTTCTATGACAGCTTCAGACAGCTTCACCAAATCCAGACTGG

Full Affymetrix probeset data:

Annotations for 1640826_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720