FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640827_at:

>probe:Drosophila_2:1640827_at:655:49; Interrogation_Position=13; Antisense; ATGCGGTACTATGAAGATCCATGTG
>probe:Drosophila_2:1640827_at:257:635; Interrogation_Position=132; Antisense; TCGGCCCGCCGAGGTAGTCTACATG
>probe:Drosophila_2:1640827_at:400:433; Interrogation_Position=142; Antisense; GAGGTAGTCTACATGACCCCGGCGG
>probe:Drosophila_2:1640827_at:192:573; Interrogation_Position=162; Antisense; GGCGGCTACCTATGTGCCCGGCACA
>probe:Drosophila_2:1640827_at:90:63; Interrogation_Position=173; Antisense; ATGTGCCCGGCACACAGGTGATAAT
>probe:Drosophila_2:1640827_at:101:155; Interrogation_Position=186; Antisense; ACAGGTGATAATGCCGCAACCCTAC
>probe:Drosophila_2:1640827_at:27:671; Interrogation_Position=208; Antisense; TACGGCGGCGTCACGGTGGCCACCA
>probe:Drosophila_2:1640827_at:90:261; Interrogation_Position=231; Antisense; CACCAATGGATACTATCCGCAGCAG
>probe:Drosophila_2:1640827_at:96:615; Interrogation_Position=24; Antisense; TGAAGATCCATGTGGCTATCCTCCT
>probe:Drosophila_2:1640827_at:501:685; Interrogation_Position=274; Antisense; TATCAGTACCAGTATCAGCAGCCCT
>probe:Drosophila_2:1640827_at:591:483; Interrogation_Position=285; Antisense; GTATCAGCAGCCCTACAACAATCCA
>probe:Drosophila_2:1640827_at:619:185; Interrogation_Position=301; Antisense; AACAATCCACCGTATCCGCAGTGGT
>probe:Drosophila_2:1640827_at:211:315; Interrogation_Position=50; Antisense; GCCATCACCATGGTCGTCCAAATAT
>probe:Drosophila_2:1640827_at:350:241; Interrogation_Position=70; Antisense; AATATCGAAATTGATGTGGTTCCCG

Paste this into a BLAST search page for me
ATGCGGTACTATGAAGATCCATGTGTCGGCCCGCCGAGGTAGTCTACATGGAGGTAGTCTACATGACCCCGGCGGGGCGGCTACCTATGTGCCCGGCACAATGTGCCCGGCACACAGGTGATAATACAGGTGATAATGCCGCAACCCTACTACGGCGGCGTCACGGTGGCCACCACACCAATGGATACTATCCGCAGCAGTGAAGATCCATGTGGCTATCCTCCTTATCAGTACCAGTATCAGCAGCCCTGTATCAGCAGCCCTACAACAATCCAAACAATCCACCGTATCCGCAGTGGTGCCATCACCATGGTCGTCCAAATATAATATCGAAATTGATGTGGTTCCCG

Full Affymetrix probeset data:

Annotations for 1640827_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720