Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640828_at:

>probe:Drosophila_2:1640828_at:637:217; Interrogation_Position=2163; Antisense; AAGTCCGACTATGATCCTAACTACG
>probe:Drosophila_2:1640828_at:517:435; Interrogation_Position=2187; Antisense; GAGGTGCTCAAAAGTCGTGCTCACT
>probe:Drosophila_2:1640828_at:407:649; Interrogation_Position=2207; Antisense; TCACTCTGACGACGGCTATGCGAAG
>probe:Drosophila_2:1640828_at:729:453; Interrogation_Position=2238; Antisense; GATAAGAAGCGTCCACCGGTGAATG
>probe:Drosophila_2:1640828_at:270:291; Interrogation_Position=2254; Antisense; CGGTGAATGCTGACGGCTCTGGCTA
>probe:Drosophila_2:1640828_at:263:525; Interrogation_Position=2293; Antisense; GGGCAGATGCCAACCACAACTATGC
>probe:Drosophila_2:1640828_at:312:277; Interrogation_Position=2312; Antisense; CTATGCCAGCATCCTCGAGACAAAG
>probe:Drosophila_2:1640828_at:77:227; Interrogation_Position=2334; Antisense; AAGGCCGCTGCGGAGACGGATCATT
>probe:Drosophila_2:1640828_at:410:247; Interrogation_Position=2445; Antisense; AATTCCGTGTCGCTTAACTCTTCAA
>probe:Drosophila_2:1640828_at:269:453; Interrogation_Position=2489; Antisense; GATCTCCTCGCAATATGAATCGCTG
>probe:Drosophila_2:1640828_at:144:177; Interrogation_Position=2530; Antisense; AAACGGATCCTAACTATGAGTCGGT
>probe:Drosophila_2:1640828_at:614:57; Interrogation_Position=2545; Antisense; ATGAGTCGGTGTGCTATCTCACCAC
>probe:Drosophila_2:1640828_at:433:155; Interrogation_Position=2595; Antisense; ACAGCGACGACCAACACTAGCAGTG
>probe:Drosophila_2:1640828_at:226:679; Interrogation_Position=2722; Antisense; TAGTGGACGACTACTTTCACGTGTA

Paste this into a BLAST search page for me
AAGTCCGACTATGATCCTAACTACGGAGGTGCTCAAAAGTCGTGCTCACTTCACTCTGACGACGGCTATGCGAAGGATAAGAAGCGTCCACCGGTGAATGCGGTGAATGCTGACGGCTCTGGCTAGGGCAGATGCCAACCACAACTATGCCTATGCCAGCATCCTCGAGACAAAGAAGGCCGCTGCGGAGACGGATCATTAATTCCGTGTCGCTTAACTCTTCAAGATCTCCTCGCAATATGAATCGCTGAAACGGATCCTAACTATGAGTCGGTATGAGTCGGTGTGCTATCTCACCACACAGCGACGACCAACACTAGCAGTGTAGTGGACGACTACTTTCACGTGTA

Full Affymetrix probeset data:

Annotations for 1640828_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime