FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640829_at:

>probe:Drosophila_2:1640829_at:604:633; Interrogation_Position=2950; Antisense; TCCCGAGATCCCTATCGGCATGAGA
>probe:Drosophila_2:1640829_at:476:509; Interrogation_Position=2981; Antisense; GTGAAAGACCCGGTGGACGCGCCCA
>probe:Drosophila_2:1640829_at:173:361; Interrogation_Position=3039; Antisense; GAATCCATCGACAACGGGTTCGGGT
>probe:Drosophila_2:1640829_at:695:65; Interrogation_Position=3073; Antisense; ATGGAGCGATATCCCTCACCAGCAG
>probe:Drosophila_2:1640829_at:426:311; Interrogation_Position=3097; Antisense; GCCACGCCCATACAATCTGTTGATG
>probe:Drosophila_2:1640829_at:616:709; Interrogation_Position=3168; Antisense; TTCTTCCGGTGGCAATTCGGGCAAG
>probe:Drosophila_2:1640829_at:598:693; Interrogation_Position=3183; Antisense; TTCGGGCAAGCCACTAACCCAAATG
>probe:Drosophila_2:1640829_at:304:25; Interrogation_Position=3218; Antisense; ATAGGCACAGCTATGCGGAGCCCGT
>probe:Drosophila_2:1640829_at:69:213; Interrogation_Position=3261; Antisense; AAGAGTTGGTCTGGCGGCAGTTAAT
>probe:Drosophila_2:1640829_at:681:429; Interrogation_Position=3293; Antisense; GAGTAGGATCCGGAACTTAGCCATT
>probe:Drosophila_2:1640829_at:25:659; Interrogation_Position=3317; Antisense; TAAGTGTGGTTCTTGCTCTTGGAAT
>probe:Drosophila_2:1640829_at:687:101; Interrogation_Position=3343; Antisense; AGAGCAGCCCTGACCAAAAGTGAAA
>probe:Drosophila_2:1640829_at:605:225; Interrogation_Position=3410; Antisense; AATGTCGCAAAAAATCTCCAGGGAT
>probe:Drosophila_2:1640829_at:651:693; Interrogation_Position=3519; Antisense; TTTCTGCGACACTCGACTAACGAAA

Paste this into a BLAST search page for me
TCCCGAGATCCCTATCGGCATGAGAGTGAAAGACCCGGTGGACGCGCCCAGAATCCATCGACAACGGGTTCGGGTATGGAGCGATATCCCTCACCAGCAGGCCACGCCCATACAATCTGTTGATGTTCTTCCGGTGGCAATTCGGGCAAGTTCGGGCAAGCCACTAACCCAAATGATAGGCACAGCTATGCGGAGCCCGTAAGAGTTGGTCTGGCGGCAGTTAATGAGTAGGATCCGGAACTTAGCCATTTAAGTGTGGTTCTTGCTCTTGGAATAGAGCAGCCCTGACCAAAAGTGAAAAATGTCGCAAAAAATCTCCAGGGATTTTCTGCGACACTCGACTAACGAAA

Full Affymetrix probeset data:

Annotations for 1640829_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720