FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640830_at:

>probe:Drosophila_2:1640830_at:479:453; Interrogation_Position=1657; Antisense; GATCATGACCGAATCGATGCCTACA
>probe:Drosophila_2:1640830_at:2:449; Interrogation_Position=1672; Antisense; GATGCCTACATTCAAGCACTGCGGC
>probe:Drosophila_2:1640830_at:627:355; Interrogation_Position=1687; Antisense; GCACTGCGGCGAAATATAACTATGA
>probe:Drosophila_2:1640830_at:80:167; Interrogation_Position=1793; Antisense; AAATGAACTGTAAACTCGGAGGCTC
>probe:Drosophila_2:1640830_at:624:277; Interrogation_Position=1807; Antisense; CTCGGAGGCTCATTATGGACGGTAA
>probe:Drosophila_2:1640830_at:283:565; Interrogation_Position=1861; Antisense; GGAATAGACTCATATCATGACCCAT
>probe:Drosophila_2:1640830_at:202:525; Interrogation_Position=1894; Antisense; GGGAATTCTGTTGCTGAAAACCCAT
>probe:Drosophila_2:1640830_at:383:175; Interrogation_Position=1911; Antisense; AAACCCATTGCCAGGAACTGTCGTA
>probe:Drosophila_2:1640830_at:719:691; Interrogation_Position=1974; Antisense; TTTGGTTTCGCAATTGGTACGACAG
>probe:Drosophila_2:1640830_at:376:489; Interrogation_Position=2000; Antisense; GTACTGTAACCCCAACTCATTATGT
>probe:Drosophila_2:1640830_at:489:59; Interrogation_Position=2021; Antisense; ATGTTGTTCTTCGAGATGACTGCAA
>probe:Drosophila_2:1640830_at:610:441; Interrogation_Position=2035; Antisense; GATGACTGCAATTATGGACCCGACA
>probe:Drosophila_2:1640830_at:505:537; Interrogation_Position=2110; Antisense; GGTACAGTACGAATTCCAGCTTGTT
>probe:Drosophila_2:1640830_at:315:661; Interrogation_Position=2199; Antisense; TAACGACTTTACTAGAGCGCTTTGA

Paste this into a BLAST search page for me
GATCATGACCGAATCGATGCCTACAGATGCCTACATTCAAGCACTGCGGCGCACTGCGGCGAAATATAACTATGAAAATGAACTGTAAACTCGGAGGCTCCTCGGAGGCTCATTATGGACGGTAAGGAATAGACTCATATCATGACCCATGGGAATTCTGTTGCTGAAAACCCATAAACCCATTGCCAGGAACTGTCGTATTTGGTTTCGCAATTGGTACGACAGGTACTGTAACCCCAACTCATTATGTATGTTGTTCTTCGAGATGACTGCAAGATGACTGCAATTATGGACCCGACAGGTACAGTACGAATTCCAGCTTGTTTAACGACTTTACTAGAGCGCTTTGA

Full Affymetrix probeset data:

Annotations for 1640830_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720