FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640831_at:

>probe:Drosophila_2:1640831_at:91:675; Interrogation_Position=368; Antisense; TAGCCGACTATGATCCAGTGCCGGT
>probe:Drosophila_2:1640831_at:284:637; Interrogation_Position=401; Antisense; TCGTCATCGACCATATCTACGCGGA
>probe:Drosophila_2:1640831_at:371:727; Interrogation_Position=496; Antisense; TTGTTTGTCAACTATACGCGCATCC
>probe:Drosophila_2:1640831_at:662:369; Interrogation_Position=529; Antisense; GAATGGGAGCGCAATCCTCGGGACC
>probe:Drosophila_2:1640831_at:654:129; Interrogation_Position=551; Antisense; ACCTAGACACGGTCAACTGGGATGT
>probe:Drosophila_2:1640831_at:280:595; Interrogation_Position=573; Antisense; TGTGAGCTACACCAAGTTTCTGATC
>probe:Drosophila_2:1640831_at:517:193; Interrogation_Position=598; Antisense; AACTCAGAGGGTTGTGGCTATCCGC
>probe:Drosophila_2:1640831_at:27:541; Interrogation_Position=659; Antisense; GGTTTTCACACATCGGAGAGCCCTT
>probe:Drosophila_2:1640831_at:308:341; Interrogation_Position=689; Antisense; GCTTCTACAGCAGGGCGTATCCGGA
>probe:Drosophila_2:1640831_at:470:105; Interrogation_Position=740; Antisense; AGAACAATCTGTACCACCTAATCCT
>probe:Drosophila_2:1640831_at:340:605; Interrogation_Position=770; Antisense; TGATCATACCGAACGTGCTCTTTGC
>probe:Drosophila_2:1640831_at:561:531; Interrogation_Position=806; Antisense; GGGTGCTCAGCTATTGGTACTGCCC
>probe:Drosophila_2:1640831_at:607:225; Interrogation_Position=841; Antisense; AAGGCGTGCAACAAATCCTCGCGGG
>probe:Drosophila_2:1640831_at:628:671; Interrogation_Position=868; Antisense; TACGCCGAGAAGTTCCCGACCAAGG

Paste this into a BLAST search page for me
TAGCCGACTATGATCCAGTGCCGGTTCGTCATCGACCATATCTACGCGGATTGTTTGTCAACTATACGCGCATCCGAATGGGAGCGCAATCCTCGGGACCACCTAGACACGGTCAACTGGGATGTTGTGAGCTACACCAAGTTTCTGATCAACTCAGAGGGTTGTGGCTATCCGCGGTTTTCACACATCGGAGAGCCCTTGCTTCTACAGCAGGGCGTATCCGGAAGAACAATCTGTACCACCTAATCCTTGATCATACCGAACGTGCTCTTTGCGGGTGCTCAGCTATTGGTACTGCCCAAGGCGTGCAACAAATCCTCGCGGGTACGCCGAGAAGTTCCCGACCAAGG

Full Affymetrix probeset data:

Annotations for 1640831_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720