FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640833_at:

>probe:Drosophila_2:1640833_at:675:9; Interrogation_Position=1048; Antisense; ATTCGCTGTACACAAAATCCCACTG
>probe:Drosophila_2:1640833_at:619:183; Interrogation_Position=1061; Antisense; AAAATCCCACTGCATTTGCGACGAC
>probe:Drosophila_2:1640833_at:303:19; Interrogation_Position=1074; Antisense; ATTTGCGACGACATGCTGTTCTCCT
>probe:Drosophila_2:1640833_at:487:603; Interrogation_Position=1090; Antisense; TGTTCTCCTGCCTGAAGATGACCAA
>probe:Drosophila_2:1640833_at:249:697; Interrogation_Position=1149; Antisense; TTTAATCTGGTGCAGGTGCCGTGTC
>probe:Drosophila_2:1640833_at:552:639; Interrogation_Position=1172; Antisense; TCTGGACGGGCGGAGCAATCATTAC
>probe:Drosophila_2:1640833_at:327:239; Interrogation_Position=1188; Antisense; AATCATTACAAGTTCCGTGCGGCCA
>probe:Drosophila_2:1640833_at:328:529; Interrogation_Position=1283; Antisense; GGGAGTCGCTCTATTTATTGTTTTA
>probe:Drosophila_2:1640833_at:558:477; Interrogation_Position=1302; Antisense; GTTTTACAAACGATGACGCCCGCTT
>probe:Drosophila_2:1640833_at:31:445; Interrogation_Position=1313; Antisense; GATGACGCCCGCTTTTTATTTTTCG
>probe:Drosophila_2:1640833_at:53:83; Interrogation_Position=888; Antisense; AGTGGCATTATACCAGGCACAAAAT
>probe:Drosophila_2:1640833_at:483:131; Interrogation_Position=921; Antisense; ACCGGCGACATTGCAGAGACGTACA
>probe:Drosophila_2:1640833_at:160:169; Interrogation_Position=961; Antisense; AAATGGCCATGGATCGATGCTGTCG
>probe:Drosophila_2:1640833_at:352:447; Interrogation_Position=976; Antisense; GATGCTGTCGGCAACACGATCTCTG

Paste this into a BLAST search page for me
ATTCGCTGTACACAAAATCCCACTGAAAATCCCACTGCATTTGCGACGACATTTGCGACGACATGCTGTTCTCCTTGTTCTCCTGCCTGAAGATGACCAATTTAATCTGGTGCAGGTGCCGTGTCTCTGGACGGGCGGAGCAATCATTACAATCATTACAAGTTCCGTGCGGCCAGGGAGTCGCTCTATTTATTGTTTTAGTTTTACAAACGATGACGCCCGCTTGATGACGCCCGCTTTTTATTTTTCGAGTGGCATTATACCAGGCACAAAATACCGGCGACATTGCAGAGACGTACAAAATGGCCATGGATCGATGCTGTCGGATGCTGTCGGCAACACGATCTCTG

Full Affymetrix probeset data:

Annotations for 1640833_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720