FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640834_at:

>probe:Drosophila_2:1640834_at:476:51; Interrogation_Position=119; Antisense; ATGCGAGGCCCAAACATCGCGGATG
>probe:Drosophila_2:1640834_at:236:69; Interrogation_Position=141; Antisense; ATGGCGCGTCCAGGATGGGCACCAC
>probe:Drosophila_2:1640834_at:690:497; Interrogation_Position=166; Antisense; GTCTCCGAGGGCACAATACTGGCCA
>probe:Drosophila_2:1640834_at:627:181; Interrogation_Position=17; Antisense; AAAAGCTGACCATGCAGTGCCTGAA
>probe:Drosophila_2:1640834_at:482:697; Interrogation_Position=208; Antisense; TTTCATCCGGGCCTGAATGTGGGCT
>probe:Drosophila_2:1640834_at:403:361; Interrogation_Position=239; Antisense; GCAATGGAACCCTTTTCGCCATGGA
>probe:Drosophila_2:1640834_at:427:699; Interrogation_Position=275; Antisense; TTTATGTGACCTGCGAGGCCATCGA
>probe:Drosophila_2:1640834_at:481:593; Interrogation_Position=307; Antisense; TGGGACCACACCTGGATTCAGCGGA
>probe:Drosophila_2:1640834_at:639:541; Interrogation_Position=320; Antisense; GGATTCAGCGGAACTACGCCGGTCG
>probe:Drosophila_2:1640834_at:437:503; Interrogation_Position=341; Antisense; GTCGCCAGGGCCAGAACATCTACAA
>probe:Drosophila_2:1640834_at:601:373; Interrogation_Position=366; Antisense; GAAGTTCTTCAATGTTGTGCCCGAA
>probe:Drosophila_2:1640834_at:73:285; Interrogation_Position=37; Antisense; CTGAAGGCAGACCAGCCGCTGATGA
>probe:Drosophila_2:1640834_at:408:35; Interrogation_Position=392; Antisense; ATCAGCATCAGCGATTTCGTCTAGT
>probe:Drosophila_2:1640834_at:551:261; Interrogation_Position=63; Antisense; CACCGTGCGCAATGCCAGCAAGAAA

Paste this into a BLAST search page for me
ATGCGAGGCCCAAACATCGCGGATGATGGCGCGTCCAGGATGGGCACCACGTCTCCGAGGGCACAATACTGGCCAAAAAGCTGACCATGCAGTGCCTGAATTTCATCCGGGCCTGAATGTGGGCTGCAATGGAACCCTTTTCGCCATGGATTTATGTGACCTGCGAGGCCATCGATGGGACCACACCTGGATTCAGCGGAGGATTCAGCGGAACTACGCCGGTCGGTCGCCAGGGCCAGAACATCTACAAGAAGTTCTTCAATGTTGTGCCCGAACTGAAGGCAGACCAGCCGCTGATGAATCAGCATCAGCGATTTCGTCTAGTCACCGTGCGCAATGCCAGCAAGAAA

Full Affymetrix probeset data:

Annotations for 1640834_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720