FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640836_at:

>probe:Drosophila_2:1640836_at:605:611; Interrogation_Position=1009; Antisense; TGAACACGGTTGCTGTTCCAACGCA
>probe:Drosophila_2:1640836_at:41:721; Interrogation_Position=1024; Antisense; TTCCAACGCACTTCTTCAAAATCAT
>probe:Drosophila_2:1640836_at:181:603; Interrogation_Position=1097; Antisense; TGTTGTTCCCAATGCATATGTCGAC
>probe:Drosophila_2:1640836_at:493:397; Interrogation_Position=1119; Antisense; GACAAGGATATGGATCTGCGCTCAT
>probe:Drosophila_2:1640836_at:650:623; Interrogation_Position=1135; Antisense; TGCGCTCATTTTTAGCCGATGTTCG
>probe:Drosophila_2:1640836_at:522:459; Interrogation_Position=1161; Antisense; GATATTGAACACTTCGCAGGACTCA
>probe:Drosophila_2:1640836_at:484:641; Interrogation_Position=1189; Antisense; TCTGTGATGGCCAGCAGCGGGATCA
>probe:Drosophila_2:1640836_at:15:301; Interrogation_Position=1234; Antisense; CGCCCTCAATGACGGATTTCCAGAA
>probe:Drosophila_2:1640836_at:236:243; Interrogation_Position=750; Antisense; AATTCCGATTGGGTTGGTGGTCACT
>probe:Drosophila_2:1640836_at:372:321; Interrogation_Position=804; Antisense; GCGCTGAAGTTTTTGGAGGCCTACA
>probe:Drosophila_2:1640836_at:490:707; Interrogation_Position=832; Antisense; TTACGAATATCGTGCCCATTAATCG
>probe:Drosophila_2:1640836_at:389:91; Interrogation_Position=926; Antisense; AGTTCATGTTTATACCGGTCCTCTG
>probe:Drosophila_2:1640836_at:121:537; Interrogation_Position=942; Antisense; GGTCCTCTGTTTATGCCCCAAAGGA
>probe:Drosophila_2:1640836_at:46:143; Interrogation_Position=979; Antisense; ACTGGTCTGTGCGTTACCATGTAAT

Paste this into a BLAST search page for me
TGAACACGGTTGCTGTTCCAACGCATTCCAACGCACTTCTTCAAAATCATTGTTGTTCCCAATGCATATGTCGACGACAAGGATATGGATCTGCGCTCATTGCGCTCATTTTTAGCCGATGTTCGGATATTGAACACTTCGCAGGACTCATCTGTGATGGCCAGCAGCGGGATCACGCCCTCAATGACGGATTTCCAGAAAATTCCGATTGGGTTGGTGGTCACTGCGCTGAAGTTTTTGGAGGCCTACATTACGAATATCGTGCCCATTAATCGAGTTCATGTTTATACCGGTCCTCTGGGTCCTCTGTTTATGCCCCAAAGGAACTGGTCTGTGCGTTACCATGTAAT

Full Affymetrix probeset data:

Annotations for 1640836_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720