Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640837_a_at:

>probe:Drosophila_2:1640837_a_at:279:411; Interrogation_Position=1025; Antisense; GACCCAACCCAAGGGCAAGGACATT
>probe:Drosophila_2:1640837_a_at:391:457; Interrogation_Position=1050; Antisense; GATAGGCTCAAGTACCAAGTAGCTT
>probe:Drosophila_2:1640837_a_at:322:433; Interrogation_Position=579; Antisense; GAGTGCCAGGCGAAATATCCGCAGG
>probe:Drosophila_2:1640837_a_at:18:75; Interrogation_Position=601; Antisense; AGGAAACTGCCTATGCCGACAAGAA
>probe:Drosophila_2:1640837_a_at:511:209; Interrogation_Position=621; Antisense; AAGAAGTTCCGGTCATCGCCTTATT
>probe:Drosophila_2:1640837_a_at:393:45; Interrogation_Position=635; Antisense; ATCGCCTTATTTCCGGGATGCGGCC
>probe:Drosophila_2:1640837_a_at:194:447; Interrogation_Position=651; Antisense; GATGCGGCCATCGTGGAGCAATTGA
>probe:Drosophila_2:1640837_a_at:649:249; Interrogation_Position=818; Antisense; CAAGCAGAAGGATCCCCTTTCCCTA
>probe:Drosophila_2:1640837_a_at:169:301; Interrogation_Position=832; Antisense; CCCTTTCCCTAATGCCACAGAAGAA
>probe:Drosophila_2:1640837_a_at:592:233; Interrogation_Position=862; Antisense; AATCCACCCAGAAGCCAGTGCCAGT
>probe:Drosophila_2:1640837_a_at:240:309; Interrogation_Position=876; Antisense; CCAGTGCCAGTTCCTATTCAAGTAG
>probe:Drosophila_2:1640837_a_at:147:485; Interrogation_Position=897; Antisense; GTAGCAGTTCCAAAACCAGTTTCAG
>probe:Drosophila_2:1640837_a_at:320:213; Interrogation_Position=936; Antisense; AAGACGACCGAGGACATCGCTATGC
>probe:Drosophila_2:1640837_a_at:623:683; Interrogation_Position=956; Antisense; TATGCCGCCTATGCCACTGAAGGAC

Paste this into a BLAST search page for me
GACCCAACCCAAGGGCAAGGACATTGATAGGCTCAAGTACCAAGTAGCTTGAGTGCCAGGCGAAATATCCGCAGGAGGAAACTGCCTATGCCGACAAGAAAAGAAGTTCCGGTCATCGCCTTATTATCGCCTTATTTCCGGGATGCGGCCGATGCGGCCATCGTGGAGCAATTGACAAGCAGAAGGATCCCCTTTCCCTACCCTTTCCCTAATGCCACAGAAGAAAATCCACCCAGAAGCCAGTGCCAGTCCAGTGCCAGTTCCTATTCAAGTAGGTAGCAGTTCCAAAACCAGTTTCAGAAGACGACCGAGGACATCGCTATGCTATGCCGCCTATGCCACTGAAGGAC

Full Affymetrix probeset data:

Annotations for 1640837_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime