Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640841_at:

>probe:Drosophila_2:1640841_at:85:525; Interrogation_Position=1606; Antisense; GGGCGGCAGGCAGAAAATTTATATC
>probe:Drosophila_2:1640841_at:648:29; Interrogation_Position=1676; Antisense; ATACAATCCAATCGAACCTACCAAC
>probe:Drosophila_2:1640841_at:175:203; Interrogation_Position=1710; Antisense; AACCAAGCAACAAAACCGCAAGCAA
>probe:Drosophila_2:1640841_at:533:373; Interrogation_Position=1738; Antisense; GAAGAACTACAACTACTTAGCTAAA
>probe:Drosophila_2:1640841_at:229:241; Interrogation_Position=1779; Antisense; AATAACGAACTAAGCGTCGCAGCAG
>probe:Drosophila_2:1640841_at:625:205; Interrogation_Position=1790; Antisense; AAGCGTCGCAGCAGAAAGCCAGGGA
>probe:Drosophila_2:1640841_at:633:439; Interrogation_Position=1831; Antisense; GATGGACTCATGGATTATGACGTGA
>probe:Drosophila_2:1640841_at:583:331; Interrogation_Position=1876; Antisense; GCTGACAAAGGACTAAACGGGACGA
>probe:Drosophila_2:1640841_at:136:411; Interrogation_Position=1904; Antisense; GACGAACGCCAGGACGTAGCAGCAT
>probe:Drosophila_2:1640841_at:224:351; Interrogation_Position=1922; Antisense; GCAGCATAAGCAAGCAGCAGCGGTA
>probe:Drosophila_2:1640841_at:127:377; Interrogation_Position=1956; Antisense; GAAGCAGAAGCAGACGACCCACGAC
>probe:Drosophila_2:1640841_at:340:411; Interrogation_Position=1971; Antisense; GACCCACGACCGACAAAGCAGGAAG
>probe:Drosophila_2:1640841_at:97:563; Interrogation_Position=1991; Antisense; GGAAGATAACGATGAAGCAGCAGCA
>probe:Drosophila_2:1640841_at:122:525; Interrogation_Position=2078; Antisense; GGGCGGGCCAGCGATTTATATAAAA

Paste this into a BLAST search page for me
GGGCGGCAGGCAGAAAATTTATATCATACAATCCAATCGAACCTACCAACAACCAAGCAACAAAACCGCAAGCAAGAAGAACTACAACTACTTAGCTAAAAATAACGAACTAAGCGTCGCAGCAGAAGCGTCGCAGCAGAAAGCCAGGGAGATGGACTCATGGATTATGACGTGAGCTGACAAAGGACTAAACGGGACGAGACGAACGCCAGGACGTAGCAGCATGCAGCATAAGCAAGCAGCAGCGGTAGAAGCAGAAGCAGACGACCCACGACGACCCACGACCGACAAAGCAGGAAGGGAAGATAACGATGAAGCAGCAGCAGGGCGGGCCAGCGATTTATATAAAA

Full Affymetrix probeset data:

Annotations for 1640841_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime