FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640845_at:

>probe:Drosophila_2:1640845_at:504:169; Interrogation_Position=121; Antisense; AAAGAATCGGCTTCGACGTGGTCAC
>probe:Drosophila_2:1640845_at:624:233; Interrogation_Position=164; Antisense; AATCCTATCTCGCAAGAATCCCGGG
>probe:Drosophila_2:1640845_at:119:555; Interrogation_Position=188; Antisense; GGACCAGCTGCGACGACCCAAAGTG
>probe:Drosophila_2:1640845_at:392:99; Interrogation_Position=215; Antisense; AGAGTATTCGGTGTTTGTGCAGGAC
>probe:Drosophila_2:1640845_at:274:263; Interrogation_Position=259; Antisense; CAGTACTTGGCACACAGGATTCCCA
>probe:Drosophila_2:1640845_at:63:79; Interrogation_Position=274; Antisense; AGGATTCCCAACCAGAGCCGGATCT
>probe:Drosophila_2:1640845_at:597:317; Interrogation_Position=290; Antisense; GCCGGATCTCCTGGTCGTGGATGAA
>probe:Drosophila_2:1640845_at:360:253; Interrogation_Position=338; Antisense; CAAGCGATTTGAGTCGGCCATGGCT
>probe:Drosophila_2:1640845_at:485:579; Interrogation_Position=353; Antisense; GGCCATGGCTGATCTCCTGAAGAAA
>probe:Drosophila_2:1640845_at:617:181; Interrogation_Position=376; Antisense; AAAAGCGGGCCCTATTGGTCACCAT
>probe:Drosophila_2:1640845_at:699:241; Interrogation_Position=41; Antisense; AATATGCTCGGCTCTGCAGGATAGA
>probe:Drosophila_2:1640845_at:665:545; Interrogation_Position=450; Antisense; GGATCCAAGATTTACCAGGTGACCA
>probe:Drosophila_2:1640845_at:193:381; Interrogation_Position=485; Antisense; GAACGCCTTGGCTGGAGAGATTACA
>probe:Drosophila_2:1640845_at:629:437; Interrogation_Position=64; Antisense; GAGGACGCATTCTTCAAGGATTCTA

Paste this into a BLAST search page for me
AAAGAATCGGCTTCGACGTGGTCACAATCCTATCTCGCAAGAATCCCGGGGGACCAGCTGCGACGACCCAAAGTGAGAGTATTCGGTGTTTGTGCAGGACCAGTACTTGGCACACAGGATTCCCAAGGATTCCCAACCAGAGCCGGATCTGCCGGATCTCCTGGTCGTGGATGAACAAGCGATTTGAGTCGGCCATGGCTGGCCATGGCTGATCTCCTGAAGAAAAAAAGCGGGCCCTATTGGTCACCATAATATGCTCGGCTCTGCAGGATAGAGGATCCAAGATTTACCAGGTGACCAGAACGCCTTGGCTGGAGAGATTACAGAGGACGCATTCTTCAAGGATTCTA

Full Affymetrix probeset data:

Annotations for 1640845_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720