FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640846_at:

>probe:Drosophila_2:1640846_at:262:411; Interrogation_Position=1058; Antisense; GACGCCATATCCAAAGAACTCGCAT
>probe:Drosophila_2:1640846_at:300:399; Interrogation_Position=1119; Antisense; GACACCTGGAGATGTTATCCGTCTT
>probe:Drosophila_2:1640846_at:185:245; Interrogation_Position=688; Antisense; AATTCTCACTGTCAAGATACCTCCG
>probe:Drosophila_2:1640846_at:491:27; Interrogation_Position=704; Antisense; ATACCTCCGGGCTGTAAGGCTGGCA
>probe:Drosophila_2:1640846_at:611:251; Interrogation_Position=730; Antisense; CAAGATCTGCTTTCCCAATGAGGGT
>probe:Drosophila_2:1640846_at:307:53; Interrogation_Position=747; Antisense; ATGAGGGTATTCAACTGCCCAACCT
>probe:Drosophila_2:1640846_at:682:117; Interrogation_Position=774; Antisense; AGCCCGCCAACGTCGTGTTTATAAT
>probe:Drosophila_2:1640846_at:665:315; Interrogation_Position=854; Antisense; GCCGAAATCTCGCTGAAGGATGCTC
>probe:Drosophila_2:1640846_at:8:225; Interrogation_Position=869; Antisense; AAGGATGCTCTGTGCGGTTTACACG
>probe:Drosophila_2:1640846_at:435:477; Interrogation_Position=885; Antisense; GTTTACACGTGATGGTGCCGACGCT
>probe:Drosophila_2:1640846_at:69:439; Interrogation_Position=922; Antisense; GATGGAACTCAAGACCGACGTGGGC
>probe:Drosophila_2:1640846_at:710:537; Interrogation_Position=949; Antisense; GGTAATCAGTCCGAAATCCGTGCGC
>probe:Drosophila_2:1640846_at:9:671; Interrogation_Position=986; Antisense; TACGGATTGCCCGATTCCATTAATA
>probe:Drosophila_2:1640846_at:207:7; Interrogation_Position=999; Antisense; ATTCCATTAATAATTCCCGTCGCGG

Paste this into a BLAST search page for me
GACGCCATATCCAAAGAACTCGCATGACACCTGGAGATGTTATCCGTCTTAATTCTCACTGTCAAGATACCTCCGATACCTCCGGGCTGTAAGGCTGGCACAAGATCTGCTTTCCCAATGAGGGTATGAGGGTATTCAACTGCCCAACCTAGCCCGCCAACGTCGTGTTTATAATGCCGAAATCTCGCTGAAGGATGCTCAAGGATGCTCTGTGCGGTTTACACGGTTTACACGTGATGGTGCCGACGCTGATGGAACTCAAGACCGACGTGGGCGGTAATCAGTCCGAAATCCGTGCGCTACGGATTGCCCGATTCCATTAATAATTCCATTAATAATTCCCGTCGCGG

Full Affymetrix probeset data:

Annotations for 1640846_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720