FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640848_at:

>probe:Drosophila_2:1640848_at:205:479; Interrogation_Position=1020; Antisense; GTTTACGCGCGCAAATGGAATCTCT
>probe:Drosophila_2:1640848_at:287:229; Interrogation_Position=1033; Antisense; AATGGAATCTCTCTCATATGCCGCG
>probe:Drosophila_2:1640848_at:141:547; Interrogation_Position=1074; Antisense; GGATGGCTTCCGTTGGCATTTTGGC
>probe:Drosophila_2:1640848_at:430:341; Interrogation_Position=1089; Antisense; GCATTTTGGCCAACTTCTTGTTACC
>probe:Drosophila_2:1640848_at:265:475; Interrogation_Position=1108; Antisense; GTTACCATATGGTCAGCACCCAACT
>probe:Drosophila_2:1640848_at:379:335; Interrogation_Position=1142; Antisense; GCTGCGGCAACAAAGCGGCTATTCT
>probe:Drosophila_2:1640848_at:513:689; Interrogation_Position=1161; Antisense; TATTCTGCGCTTAAATGCTGCTGGC
>probe:Drosophila_2:1640848_at:628:707; Interrogation_Position=1196; Antisense; TTAAAGTGTTCGAAGCGCAGGCGCT
>probe:Drosophila_2:1640848_at:24:43; Interrogation_Position=1283; Antisense; ATCGCTATCTGAATCTTATCCCAAG
>probe:Drosophila_2:1640848_at:243:579; Interrogation_Position=844; Antisense; GGCCTGTCGCCGGATATGCAACGAT
>probe:Drosophila_2:1640848_at:297:3; Interrogation_Position=867; Antisense; ATTGGATGACTTACGTAGCCTGGAT
>probe:Drosophila_2:1640848_at:75:675; Interrogation_Position=882; Antisense; TAGCCTGGATCGCTGCCACGAGATA
>probe:Drosophila_2:1640848_at:644:685; Interrogation_Position=921; Antisense; TATAGCTGATCTTCTCTGGAGCGAT
>probe:Drosophila_2:1640848_at:200:151; Interrogation_Position=984; Antisense; ACATGGAAAACTCTTCGGTGGCGAT

Paste this into a BLAST search page for me
GTTTACGCGCGCAAATGGAATCTCTAATGGAATCTCTCTCATATGCCGCGGGATGGCTTCCGTTGGCATTTTGGCGCATTTTGGCCAACTTCTTGTTACCGTTACCATATGGTCAGCACCCAACTGCTGCGGCAACAAAGCGGCTATTCTTATTCTGCGCTTAAATGCTGCTGGCTTAAAGTGTTCGAAGCGCAGGCGCTATCGCTATCTGAATCTTATCCCAAGGGCCTGTCGCCGGATATGCAACGATATTGGATGACTTACGTAGCCTGGATTAGCCTGGATCGCTGCCACGAGATATATAGCTGATCTTCTCTGGAGCGATACATGGAAAACTCTTCGGTGGCGAT

Full Affymetrix probeset data:

Annotations for 1640848_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720