FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640849_at:

>probe:Drosophila_2:1640849_at:222:67; Interrogation_Position=101; Antisense; ATGGAGCCCATATCACATCTGGTGA
>probe:Drosophila_2:1640849_at:126:593; Interrogation_Position=120; Antisense; TGGTGAAGTCCTCGCTGCCCAATTA
>probe:Drosophila_2:1640849_at:695:13; Interrogation_Position=141; Antisense; ATTACTTGTCAAGTCTGCCGGTTCC
>probe:Drosophila_2:1640849_at:312:283; Interrogation_Position=181; Antisense; CTGGTTTAAGCTCTCCTTCAAGGAT
>probe:Drosophila_2:1640849_at:194:251; Interrogation_Position=199; Antisense; CAAGGATTGGTTGGCCCTGATCCCA
>probe:Drosophila_2:1640849_at:159:627; Interrogation_Position=330; Antisense; TCCGCAAGAACGAGCCCAAGGTGGT
>probe:Drosophila_2:1640849_at:465:715; Interrogation_Position=395; Antisense; TTCTGTCGCTGCTGGAAGACCAAGA
>probe:Drosophila_2:1640849_at:465:211; Interrogation_Position=416; Antisense; AAGAACTGGCCCTACTGCGATGGCA
>probe:Drosophila_2:1640849_at:461:327; Interrogation_Position=432; Antisense; GCGATGGCAGTCATGGCGAGCACAA
>probe:Drosophila_2:1640849_at:128:407; Interrogation_Position=463; Antisense; GACTGGAGACAACGTCGGACCAATT
>probe:Drosophila_2:1640849_at:653:7; Interrogation_Position=503; Antisense; ATTGCGGCGGTGCATCGATACACAA
>probe:Drosophila_2:1640849_at:724:157; Interrogation_Position=522; Antisense; ACACAAACGTTCTAGCATTTCCTCT
>probe:Drosophila_2:1640849_at:671:411; Interrogation_Position=551; Antisense; GAGCTCCAGTTTGCTTTTAAAACCA
>probe:Drosophila_2:1640849_at:643:577; Interrogation_Position=584; Antisense; GGCCGAAGCTGTTTGAACCCTTGTA

Paste this into a BLAST search page for me
ATGGAGCCCATATCACATCTGGTGATGGTGAAGTCCTCGCTGCCCAATTAATTACTTGTCAAGTCTGCCGGTTCCCTGGTTTAAGCTCTCCTTCAAGGATCAAGGATTGGTTGGCCCTGATCCCATCCGCAAGAACGAGCCCAAGGTGGTTTCTGTCGCTGCTGGAAGACCAAGAAAGAACTGGCCCTACTGCGATGGCAGCGATGGCAGTCATGGCGAGCACAAGACTGGAGACAACGTCGGACCAATTATTGCGGCGGTGCATCGATACACAAACACAAACGTTCTAGCATTTCCTCTGAGCTCCAGTTTGCTTTTAAAACCAGGCCGAAGCTGTTTGAACCCTTGTA

Full Affymetrix probeset data:

Annotations for 1640849_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720