Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640850_at:

>probe:Drosophila_2:1640850_at:114:397; Interrogation_Position=1782; Antisense; GACAAATACGCGCACAAGCAAACTC
>probe:Drosophila_2:1640850_at:433:239; Interrogation_Position=1786; Antisense; AATACGCGCACAAGCAAACTCGTCG
>probe:Drosophila_2:1640850_at:549:357; Interrogation_Position=1793; Antisense; GCACAAGCAAACTCGTCGCGGGAAA
>probe:Drosophila_2:1640850_at:658:159; Interrogation_Position=1795; Antisense; ACAAGCAAACTCGTCGCGGGAAATT
>probe:Drosophila_2:1640850_at:568:207; Interrogation_Position=1797; Antisense; AAGCAAACTCGTCGCGGGAAATTCG
>probe:Drosophila_2:1640850_at:296:187; Interrogation_Position=1802; Antisense; AACTCGTCGCGGGAAATTCGACAAT
>probe:Drosophila_2:1640850_at:85:297; Interrogation_Position=1809; Antisense; CGCGGGAAATTCGACAATTGGATGT
>probe:Drosophila_2:1640850_at:245:395; Interrogation_Position=1814; Antisense; GAAATTCGACAATTGGATGTTTTAA
>probe:Drosophila_2:1640850_at:508:547; Interrogation_Position=1828; Antisense; GGATGTTTTAATTGATCAGCGGATC
>probe:Drosophila_2:1640850_at:650:453; Interrogation_Position=1841; Antisense; GATCAGCGGATCAGATCAGCCGTTA
>probe:Drosophila_2:1640850_at:106:121; Interrogation_Position=1845; Antisense; AGCGGATCAGATCAGCCGTTAGATC
>probe:Drosophila_2:1640850_at:286:265; Interrogation_Position=1852; Antisense; CAGATCAGCCGTTAGATCGAACGAT
>probe:Drosophila_2:1640850_at:103:33; Interrogation_Position=1855; Antisense; ATCAGCCGTTAGATCGAACGATCCA
>probe:Drosophila_2:1640850_at:730:449; Interrogation_Position=1866; Antisense; GATCGAACGATCCAGATATATTAGA

Paste this into a BLAST search page for me
GACAAATACGCGCACAAGCAAACTCAATACGCGCACAAGCAAACTCGTCGGCACAAGCAAACTCGTCGCGGGAAAACAAGCAAACTCGTCGCGGGAAATTAAGCAAACTCGTCGCGGGAAATTCGAACTCGTCGCGGGAAATTCGACAATCGCGGGAAATTCGACAATTGGATGTGAAATTCGACAATTGGATGTTTTAAGGATGTTTTAATTGATCAGCGGATCGATCAGCGGATCAGATCAGCCGTTAAGCGGATCAGATCAGCCGTTAGATCCAGATCAGCCGTTAGATCGAACGATATCAGCCGTTAGATCGAACGATCCAGATCGAACGATCCAGATATATTAGA

Full Affymetrix probeset data:

Annotations for 1640850_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime