FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640851_at:

>probe:Drosophila_2:1640851_at:304:417; Interrogation_Position=101; Antisense; GAGCGTGGCGCTCTTTCAAGGTCAT
>probe:Drosophila_2:1640851_at:607:651; Interrogation_Position=116; Antisense; TCAAGGTCATCCTCACGAGCATTGA
>probe:Drosophila_2:1640851_at:381:393; Interrogation_Position=154; Antisense; GACAAGTTCCTGGACCTTAAGGTCG
>probe:Drosophila_2:1640851_at:415:717; Interrogation_Position=192; Antisense; TTCGGGCGAGTCAAATCTGAGCATC
>probe:Drosophila_2:1640851_at:267:555; Interrogation_Position=243; Antisense; GGACGTTCAGCTGGTGGTAGACTTT
>probe:Drosophila_2:1640851_at:604:221; Interrogation_Position=283; Antisense; AAGGGCAACTACTCTACCCTGATAA
>probe:Drosophila_2:1640851_at:236:489; Interrogation_Position=311; Antisense; GTACGCTCAACTTCTGCAAGCTGAT
>probe:Drosophila_2:1640851_at:328:445; Interrogation_Position=333; Antisense; GATGAAGCAGCGCAACTCGGATCCG
>probe:Drosophila_2:1640851_at:309:453; Interrogation_Position=369; Antisense; GATCTACGAGGACCTTCTCAAGCAC
>probe:Drosophila_2:1640851_at:240:77; Interrogation_Position=38; Antisense; AGGAGGTCATCCGAAGCTGCTGTGC
>probe:Drosophila_2:1640851_at:277:225; Interrogation_Position=406; Antisense; AAGGAGTGCCCAATCCGGAGCGGCA
>probe:Drosophila_2:1640851_at:653:533; Interrogation_Position=489; Antisense; GGCTAAGTTCCGCTTCGGCATGAAA
>probe:Drosophila_2:1640851_at:324:331; Interrogation_Position=530; Antisense; GCGGCATGATCGTACGGTCGACCAT
>probe:Drosophila_2:1640851_at:217:579; Interrogation_Position=66; Antisense; GGCCTTCATTTTGGTGGCTCTCATG

Paste this into a BLAST search page for me
GAGCGTGGCGCTCTTTCAAGGTCATTCAAGGTCATCCTCACGAGCATTGAGACAAGTTCCTGGACCTTAAGGTCGTTCGGGCGAGTCAAATCTGAGCATCGGACGTTCAGCTGGTGGTAGACTTTAAGGGCAACTACTCTACCCTGATAAGTACGCTCAACTTCTGCAAGCTGATGATGAAGCAGCGCAACTCGGATCCGGATCTACGAGGACCTTCTCAAGCACAGGAGGTCATCCGAAGCTGCTGTGCAAGGAGTGCCCAATCCGGAGCGGCAGGCTAAGTTCCGCTTCGGCATGAAAGCGGCATGATCGTACGGTCGACCATGGCCTTCATTTTGGTGGCTCTCATG

Full Affymetrix probeset data:

Annotations for 1640851_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720