FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640852_at:

>probe:Drosophila_2:1640852_at:148:429; Interrogation_Position=1012; Antisense; GAGTAAACGCGACTTCTGCGGCGAT
>probe:Drosophila_2:1640852_at:325:443; Interrogation_Position=1034; Antisense; GATGTCATCGCCAGTATGAGACGCT
>probe:Drosophila_2:1640852_at:116:521; Interrogation_Position=1070; Antisense; GTGGACAACGATTTGACTGTGGACA
>probe:Drosophila_2:1640852_at:412:393; Interrogation_Position=1124; Antisense; GAAAGGTTCGTTGCTGAAATATCGC
>probe:Drosophila_2:1640852_at:171:345; Interrogation_Position=1188; Antisense; GCATTCCCGTATTCACCGAAATCTA
>probe:Drosophila_2:1640852_at:256:1; Interrogation_Position=1232; Antisense; AAACCAGTAGTCTCGTACCAAGTAG
>probe:Drosophila_2:1640852_at:177:725; Interrogation_Position=692; Antisense; TTGCATTTTCGCTTCCACAATGGAA
>probe:Drosophila_2:1640852_at:464:491; Interrogation_Position=783; Antisense; GTAACAAGTTCAGCAAAGTCCCATT
>probe:Drosophila_2:1640852_at:324:167; Interrogation_Position=797; Antisense; AAAGTCCCATTCGAAGGAGCCCGCT
>probe:Drosophila_2:1640852_at:698:371; Interrogation_Position=809; Antisense; GAAGGAGCCCGCTATTGGAGCCAAT
>probe:Drosophila_2:1640852_at:706:53; Interrogation_Position=832; Antisense; ATGCAAGCCAAAGTGCGAGGCCGCC
>probe:Drosophila_2:1640852_at:488:439; Interrogation_Position=848; Antisense; GAGGCCGCCCTGAAAATGTCCAAGA
>probe:Drosophila_2:1640852_at:522:295; Interrogation_Position=901; Antisense; CGAGATTTACGATGCTTCACAGAGA
>probe:Drosophila_2:1640852_at:355:125; Interrogation_Position=928; Antisense; AGCCCATGCGGCGTTGGTCGAAAAG

Paste this into a BLAST search page for me
GAGTAAACGCGACTTCTGCGGCGATGATGTCATCGCCAGTATGAGACGCTGTGGACAACGATTTGACTGTGGACAGAAAGGTTCGTTGCTGAAATATCGCGCATTCCCGTATTCACCGAAATCTAAAACCAGTAGTCTCGTACCAAGTAGTTGCATTTTCGCTTCCACAATGGAAGTAACAAGTTCAGCAAAGTCCCATTAAAGTCCCATTCGAAGGAGCCCGCTGAAGGAGCCCGCTATTGGAGCCAATATGCAAGCCAAAGTGCGAGGCCGCCGAGGCCGCCCTGAAAATGTCCAAGACGAGATTTACGATGCTTCACAGAGAAGCCCATGCGGCGTTGGTCGAAAAG

Full Affymetrix probeset data:

Annotations for 1640852_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720