Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640853_at:

>probe:Drosophila_2:1640853_at:704:543; Interrogation_Position=1229; Antisense; GGATACAGCTCATCGATCAGCACGG
>probe:Drosophila_2:1640853_at:583:49; Interrogation_Position=1331; Antisense; ATGCCTACATGAAGACTTTCCGCTT
>probe:Drosophila_2:1640853_at:434:453; Interrogation_Position=1361; Antisense; GATCACCAGCGCTCTATATCGAGTG
>probe:Drosophila_2:1640853_at:610:585; Interrogation_Position=1404; Antisense; TGGACGGTGTCCAAGCCAACCATGT
>probe:Drosophila_2:1640853_at:129:173; Interrogation_Position=1444; Antisense; AAAGCAGTGACCAAGCGCGATACCT
>probe:Drosophila_2:1640853_at:712:55; Interrogation_Position=1474; Antisense; ATGACAGCCACAAACATCTCGATTC
>probe:Drosophila_2:1640853_at:59:169; Interrogation_Position=1563; Antisense; AAATGTGAACCTTTTCCAGTCCCTG
>probe:Drosophila_2:1640853_at:167:443; Interrogation_Position=1621; Antisense; GATGTGTATGCCCATCGGCAGACGA
>probe:Drosophila_2:1640853_at:328:569; Interrogation_Position=1637; Antisense; GGCAGACGAAACCTTTGTCACCACA
>probe:Drosophila_2:1640853_at:651:387; Interrogation_Position=1674; Antisense; GAAAACGTCCACATTTTCGGCATTA
>probe:Drosophila_2:1640853_at:587:705; Interrogation_Position=1720; Antisense; TTATGCGTGCTAACAGTAACCCTCT
>probe:Drosophila_2:1640853_at:569:279; Interrogation_Position=1741; Antisense; CTCTTCATTGCCTGTTCGAGACTAA
>probe:Drosophila_2:1640853_at:697:173; Interrogation_Position=1765; Antisense; AAACGTCGCAAGGAGTCCTCACTGT
>probe:Drosophila_2:1640853_at:301:489; Interrogation_Position=1788; Antisense; GTACGACTCTTATATTGCACACAAA

Paste this into a BLAST search page for me
GGATACAGCTCATCGATCAGCACGGATGCCTACATGAAGACTTTCCGCTTGATCACCAGCGCTCTATATCGAGTGTGGACGGTGTCCAAGCCAACCATGTAAAGCAGTGACCAAGCGCGATACCTATGACAGCCACAAACATCTCGATTCAAATGTGAACCTTTTCCAGTCCCTGGATGTGTATGCCCATCGGCAGACGAGGCAGACGAAACCTTTGTCACCACAGAAAACGTCCACATTTTCGGCATTATTATGCGTGCTAACAGTAACCCTCTCTCTTCATTGCCTGTTCGAGACTAAAAACGTCGCAAGGAGTCCTCACTGTGTACGACTCTTATATTGCACACAAA

Full Affymetrix probeset data:

Annotations for 1640853_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime