FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640854_at:

>probe:Drosophila_2:1640854_at:166:183; Interrogation_Position=414; Antisense; AAAACCGCTCTGGATGGTGTCTCAT
>probe:Drosophila_2:1640854_at:607:297; Interrogation_Position=465; Antisense; CGCGTAGTGTCCGTGTCGTTTAATA
>probe:Drosophila_2:1640854_at:21:661; Interrogation_Position=488; Antisense; TAAAATTCAGTATGCACCACCACCT
>probe:Drosophila_2:1640854_at:188:171; Interrogation_Position=556; Antisense; AAAGTCCTCAGGCAAGGCGTCTAAT
>probe:Drosophila_2:1640854_at:81:575; Interrogation_Position=571; Antisense; GGCGTCTAATGGACTTTATGATCGA
>probe:Drosophila_2:1640854_at:266:7; Interrogation_Position=609; Antisense; ATTGATGTGTGTGCCATGTTCAACA
>probe:Drosophila_2:1640854_at:562:189; Interrogation_Position=630; Antisense; AACATGGTGTGCTTCTGTGAACTGA
>probe:Drosophila_2:1640854_at:12:443; Interrogation_Position=653; Antisense; GATGTTTCTGGCCACTTTACCGAGC
>probe:Drosophila_2:1640854_at:244:667; Interrogation_Position=670; Antisense; TACCGAGCCACGAGCGATTGGGATT
>probe:Drosophila_2:1640854_at:57:449; Interrogation_Position=700; Antisense; GATCGTTGTCCCAGTTCACAATTGA
>probe:Drosophila_2:1640854_at:46:193; Interrogation_Position=775; Antisense; AACTAAGATCAAAACGCCCAGCTGC
>probe:Drosophila_2:1640854_at:347:641; Interrogation_Position=811; Antisense; TCTGGACCTCTAGATTCTCTCAAAA
>probe:Drosophila_2:1640854_at:665:453; Interrogation_Position=863; Antisense; GATCAACACCGTTTCTTATTCGGAA
>probe:Drosophila_2:1640854_at:435:161; Interrogation_Position=934; Antisense; ACAAGTTTTGCGAACATGTCATCTA

Paste this into a BLAST search page for me
AAAACCGCTCTGGATGGTGTCTCATCGCGTAGTGTCCGTGTCGTTTAATATAAAATTCAGTATGCACCACCACCTAAAGTCCTCAGGCAAGGCGTCTAATGGCGTCTAATGGACTTTATGATCGAATTGATGTGTGTGCCATGTTCAACAAACATGGTGTGCTTCTGTGAACTGAGATGTTTCTGGCCACTTTACCGAGCTACCGAGCCACGAGCGATTGGGATTGATCGTTGTCCCAGTTCACAATTGAAACTAAGATCAAAACGCCCAGCTGCTCTGGACCTCTAGATTCTCTCAAAAGATCAACACCGTTTCTTATTCGGAAACAAGTTTTGCGAACATGTCATCTA

Full Affymetrix probeset data:

Annotations for 1640854_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720