Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640855_at:

>probe:Drosophila_2:1640855_at:136:445; Interrogation_Position=211; Antisense; GATGATGCATTTGCCGACAGTCATT
>probe:Drosophila_2:1640855_at:102:247; Interrogation_Position=243; Antisense; AATTCTTAGAGCCATTTCCATCATA
>probe:Drosophila_2:1640855_at:654:49; Interrogation_Position=279; Antisense; ATGCGTTATTTTCAAGCCAGCTACT
>probe:Drosophila_2:1640855_at:675:393; Interrogation_Position=304; Antisense; GAAATGGATTTTCCCATGGCGCTCG
>probe:Drosophila_2:1640855_at:613:67; Interrogation_Position=319; Antisense; ATGGCGCTCGTCATTACGTCAAAAG
>probe:Drosophila_2:1640855_at:92:363; Interrogation_Position=353; Antisense; GCAATACCGTTCACTTGGGCTATAG
>probe:Drosophila_2:1640855_at:80:429; Interrogation_Position=403; Antisense; GAGATTTACCCACTTGGCGAAGGCT
>probe:Drosophila_2:1640855_at:456:717; Interrogation_Position=431; Antisense; TTCGCATCGGTTCCATTATCCACGA
>probe:Drosophila_2:1640855_at:3:629; Interrogation_Position=458; Antisense; TCCTTCACGTTTTGGGCTTCGAACA
>probe:Drosophila_2:1640855_at:420:343; Interrogation_Position=473; Antisense; GCTTCGAACATCAGCATGTGTCCCA
>probe:Drosophila_2:1640855_at:234:529; Interrogation_Position=503; Antisense; GGGACCAATACGTCAGCATCCAGTG
>probe:Drosophila_2:1640855_at:517:453; Interrogation_Position=571; Antisense; GATAATTCTACAGCGTGGCACGACT
>probe:Drosophila_2:1640855_at:586:627; Interrogation_Position=635; Antisense; TGCCAAGGGCCTTTTCCAGGAATGG
>probe:Drosophila_2:1640855_at:512:71; Interrogation_Position=652; Antisense; AGGAATGGCCAACCCACAATTGTGC

Paste this into a BLAST search page for me
GATGATGCATTTGCCGACAGTCATTAATTCTTAGAGCCATTTCCATCATAATGCGTTATTTTCAAGCCAGCTACTGAAATGGATTTTCCCATGGCGCTCGATGGCGCTCGTCATTACGTCAAAAGGCAATACCGTTCACTTGGGCTATAGGAGATTTACCCACTTGGCGAAGGCTTTCGCATCGGTTCCATTATCCACGATCCTTCACGTTTTGGGCTTCGAACAGCTTCGAACATCAGCATGTGTCCCAGGGACCAATACGTCAGCATCCAGTGGATAATTCTACAGCGTGGCACGACTTGCCAAGGGCCTTTTCCAGGAATGGAGGAATGGCCAACCCACAATTGTGC

Full Affymetrix probeset data:

Annotations for 1640855_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime