Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640857_at:

>probe:Drosophila_2:1640857_at:84:69; Interrogation_Position=509; Antisense; ATGGCCACCTTTGTGTTTGATTCCC
>probe:Drosophila_2:1640857_at:3:535; Interrogation_Position=563; Antisense; GGTGCTCTGCACGACGTAATTGGAA
>probe:Drosophila_2:1640857_at:638:1; Interrogation_Position=581; Antisense; ATTGGAACACGGTGCGACGACTACA
>probe:Drosophila_2:1640857_at:461:409; Interrogation_Position=596; Antisense; GACGACTACACCTACAAGCTAATCA
>probe:Drosophila_2:1640857_at:674:153; Interrogation_Position=648; Antisense; ACAGTTCCCTAGTCAAGGCGGTGGT
>probe:Drosophila_2:1640857_at:582:131; Interrogation_Position=689; Antisense; ACCGAGCAGGATGTACACGACGTGT
>probe:Drosophila_2:1640857_at:538:561; Interrogation_Position=714; Antisense; GGAACATCTTTATGTGCACCGGATT
>probe:Drosophila_2:1640857_at:165:157; Interrogation_Position=740; Antisense; ACACGGGACACGCATCAGTATTTCT
>probe:Drosophila_2:1640857_at:719:429; Interrogation_Position=800; Antisense; GAGTTTGTGGCCGACATGAATCTTC
>probe:Drosophila_2:1640857_at:274:55; Interrogation_Position=815; Antisense; ATGAATCTTCTGGTGGCTCTGAGCG
>probe:Drosophila_2:1640857_at:531:223; Interrogation_Position=908; Antisense; AAGGTCGAAGTGTTCCGTCGCAAGT
>probe:Drosophila_2:1640857_at:286:107; Interrogation_Position=937; Antisense; AGAACCATTTTCATTCCGTGTGCGG
>probe:Drosophila_2:1640857_at:697:631; Interrogation_Position=951; Antisense; TCCGTGTGCGGAAATCTGGTTCTAA
>probe:Drosophila_2:1640857_at:620:539; Interrogation_Position=968; Antisense; GGTTCTAACAGCGTGCCATTTATGT

Paste this into a BLAST search page for me
ATGGCCACCTTTGTGTTTGATTCCCGGTGCTCTGCACGACGTAATTGGAAATTGGAACACGGTGCGACGACTACAGACGACTACACCTACAAGCTAATCAACAGTTCCCTAGTCAAGGCGGTGGTACCGAGCAGGATGTACACGACGTGTGGAACATCTTTATGTGCACCGGATTACACGGGACACGCATCAGTATTTCTGAGTTTGTGGCCGACATGAATCTTCATGAATCTTCTGGTGGCTCTGAGCGAAGGTCGAAGTGTTCCGTCGCAAGTAGAACCATTTTCATTCCGTGTGCGGTCCGTGTGCGGAAATCTGGTTCTAAGGTTCTAACAGCGTGCCATTTATGT

Full Affymetrix probeset data:

Annotations for 1640857_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime