Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640859_at:

>probe:Drosophila_2:1640859_at:480:463; Interrogation_Position=1591; Antisense; GATTCTACACGCATGTTGGGCACGG
>probe:Drosophila_2:1640859_at:243:491; Interrogation_Position=1620; Antisense; GTACAGCGCATTGTATGGAGCCCAT
>probe:Drosophila_2:1640859_at:239:689; Interrogation_Position=1648; Antisense; TATTACCATGGAGCTCTGTGTCCTT
>probe:Drosophila_2:1640859_at:646:587; Interrogation_Position=1664; Antisense; TGTGTCCTTCGATAGTTGGTACTCT
>probe:Drosophila_2:1640859_at:489:647; Interrogation_Position=1688; Antisense; TCATGCCCGCCTTGGATGGTAATAT
>probe:Drosophila_2:1640859_at:665:243; Interrogation_Position=1731; Antisense; AATATTGAGTCGTTGGTTGGCCCCG
>probe:Drosophila_2:1640859_at:239:727; Interrogation_Position=1787; Antisense; TTGATCGGGTGCCTTGGCTCAAAAA
>probe:Drosophila_2:1640859_at:385:645; Interrogation_Position=1888; Antisense; TCTATCCTATCTCTCGTACAGCAAG
>probe:Drosophila_2:1640859_at:490:319; Interrogation_Position=1923; Antisense; GCCGAATATCTACAACTGCTGCATT
>probe:Drosophila_2:1640859_at:315:195; Interrogation_Position=1936; Antisense; AACTGCTGCATTTACGTGTGCCGCG
>probe:Drosophila_2:1640859_at:153:403; Interrogation_Position=1961; Antisense; GACTTCCCGCATGGAATTTGGCCGT
>probe:Drosophila_2:1640859_at:595:725; Interrogation_Position=1978; Antisense; TTGGCCGTGGAAAAGCTGCCTTTAT
>probe:Drosophila_2:1640859_at:135:625; Interrogation_Position=1994; Antisense; TGCCTTTATAGCTCATTTCGTCGTG
>probe:Drosophila_2:1640859_at:239:419; Interrogation_Position=2019; Antisense; GAGTCGATCTCCCTAAGCAAAGTTT

Paste this into a BLAST search page for me
GATTCTACACGCATGTTGGGCACGGGTACAGCGCATTGTATGGAGCCCATTATTACCATGGAGCTCTGTGTCCTTTGTGTCCTTCGATAGTTGGTACTCTTCATGCCCGCCTTGGATGGTAATATAATATTGAGTCGTTGGTTGGCCCCGTTGATCGGGTGCCTTGGCTCAAAAATCTATCCTATCTCTCGTACAGCAAGGCCGAATATCTACAACTGCTGCATTAACTGCTGCATTTACGTGTGCCGCGGACTTCCCGCATGGAATTTGGCCGTTTGGCCGTGGAAAAGCTGCCTTTATTGCCTTTATAGCTCATTTCGTCGTGGAGTCGATCTCCCTAAGCAAAGTTT

Full Affymetrix probeset data:

Annotations for 1640859_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime