Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640861_at:

>probe:Drosophila_2:1640861_at:60:557; Interrogation_Position=178; Antisense; GGACTGTCTAAATTGCCTTGGCGAA
>probe:Drosophila_2:1640861_at:615:383; Interrogation_Position=200; Antisense; GAACTGTACATCGAGTGCTGTGGCT
>probe:Drosophila_2:1640861_at:103:301; Interrogation_Position=270; Antisense; CGCCGCGCTCGGAGATTGGAGACAT
>probe:Drosophila_2:1640861_at:170:275; Interrogation_Position=292; Antisense; CATTGAAGGAGTGCCCGAGCTGTTC
>probe:Drosophila_2:1640861_at:41:547; Interrogation_Position=334; Antisense; GGATGACGAGGGATGGTCCACCATA
>probe:Drosophila_2:1640861_at:322:31; Interrogation_Position=356; Antisense; ATAAGGTTCTCCATGCGAGCCGGCT
>probe:Drosophila_2:1640861_at:203:167; Interrogation_Position=439; Antisense; AAATGCCGGGTCTGCAGGTGTCACC
>probe:Drosophila_2:1640861_at:633:133; Interrogation_Position=461; Antisense; ACCCTATGCACCGTGATCTATGTGA
>probe:Drosophila_2:1640861_at:318:277; Interrogation_Position=478; Antisense; CTATGTGAACTCGTGCATTCGGGCA
>probe:Drosophila_2:1640861_at:26:89; Interrogation_Position=539; Antisense; AGTAGCTATCGATGGTTCCACGACG
>probe:Drosophila_2:1640861_at:725:325; Interrogation_Position=576; Antisense; GCGTCGGCGAGAATTGCCTCAATTA
>probe:Drosophila_2:1640861_at:714:365; Interrogation_Position=603; Antisense; GAATCAACGAGAGTCGCTGCCGCGG
>probe:Drosophila_2:1640861_at:675:435; Interrogation_Position=635; Antisense; GAGGATCAGGACCAACTGCTTACCG
>probe:Drosophila_2:1640861_at:282:641; Interrogation_Position=691; Antisense; TCTGGAGCGATTCTTTGGCAACGAG

Paste this into a BLAST search page for me
GGACTGTCTAAATTGCCTTGGCGAAGAACTGTACATCGAGTGCTGTGGCTCGCCGCGCTCGGAGATTGGAGACATCATTGAAGGAGTGCCCGAGCTGTTCGGATGACGAGGGATGGTCCACCATAATAAGGTTCTCCATGCGAGCCGGCTAAATGCCGGGTCTGCAGGTGTCACCACCCTATGCACCGTGATCTATGTGACTATGTGAACTCGTGCATTCGGGCAAGTAGCTATCGATGGTTCCACGACGGCGTCGGCGAGAATTGCCTCAATTAGAATCAACGAGAGTCGCTGCCGCGGGAGGATCAGGACCAACTGCTTACCGTCTGGAGCGATTCTTTGGCAACGAG

Full Affymetrix probeset data:

Annotations for 1640861_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime