Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640866_at:

>probe:Drosophila_2:1640866_at:629:297; Interrogation_Position=1686; Antisense; TCATAGCCCGAAAAGCTTAACCTTG
>probe:Drosophila_2:1640866_at:377:403; Interrogation_Position=1725; Antisense; GACTTATAAAGTTGATCCATCTGTT
>probe:Drosophila_2:1640866_at:212:449; Interrogation_Position=1738; Antisense; GATCCATCTGTTTCAAGCACGAGCT
>probe:Drosophila_2:1640866_at:702:207; Interrogation_Position=1752; Antisense; AAGCACGAGCTCATTACAACTAGAT
>probe:Drosophila_2:1640866_at:213:691; Interrogation_Position=1831; Antisense; TTTGAGAGGCAACTGCAATATACCC
>probe:Drosophila_2:1640866_at:77:725; Interrogation_Position=1886; Antisense; TTGATCGCAAACTCGAAGAACAGCT
>probe:Drosophila_2:1640866_at:117:657; Interrogation_Position=1958; Antisense; TAATCGCAGAACGTTTAGCTAAATT
>probe:Drosophila_2:1640866_at:461:117; Interrogation_Position=1974; Antisense; AGCTAAATTAGACACGCCGAAGGAA
>probe:Drosophila_2:1640866_at:646:433; Interrogation_Position=2023; Antisense; GAGGCTGAAGCCATGGATTTTCCAA
>probe:Drosophila_2:1640866_at:125:147; Interrogation_Position=2073; Antisense; ACTTTTGGACCAAATCGCTTCGCTA
>probe:Drosophila_2:1640866_at:24:167; Interrogation_Position=2084; Antisense; AAATCGCTTCGCTACAACAGCAAAT
>probe:Drosophila_2:1640866_at:507:551; Interrogation_Position=2130; Antisense; GGAGAATACTGAACATAGAGCCGAT
>probe:Drosophila_2:1640866_at:410:677; Interrogation_Position=2145; Antisense; TAGAGCCGATCTATGCGATGCTGAA
>probe:Drosophila_2:1640866_at:14:447; Interrogation_Position=2205; Antisense; GATGAATAGAGTTCAGGCTGTCAAA

Paste this into a BLAST search page for me
TCATAGCCCGAAAAGCTTAACCTTGGACTTATAAAGTTGATCCATCTGTTGATCCATCTGTTTCAAGCACGAGCTAAGCACGAGCTCATTACAACTAGATTTTGAGAGGCAACTGCAATATACCCTTGATCGCAAACTCGAAGAACAGCTTAATCGCAGAACGTTTAGCTAAATTAGCTAAATTAGACACGCCGAAGGAAGAGGCTGAAGCCATGGATTTTCCAAACTTTTGGACCAAATCGCTTCGCTAAAATCGCTTCGCTACAACAGCAAATGGAGAATACTGAACATAGAGCCGATTAGAGCCGATCTATGCGATGCTGAAGATGAATAGAGTTCAGGCTGTCAAA

Full Affymetrix probeset data:

Annotations for 1640866_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime