Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640868_at:

>probe:Drosophila_2:1640868_at:5:59; Interrogation_Position=1005; Antisense; ATGATGGATCCTTTGACTTGGCCGA
>probe:Drosophila_2:1640868_at:280:609; Interrogation_Position=1033; Antisense; TGAGAACCAAGATGCCGCTGCCGGA
>probe:Drosophila_2:1640868_at:98:209; Interrogation_Position=1082; Antisense; AAGCAGATCACACCCGTCGTGAAGA
>probe:Drosophila_2:1640868_at:72:123; Interrogation_Position=1137; Antisense; AGCGTCGTCGGATGCAGAACCTCAA
>probe:Drosophila_2:1640868_at:41:483; Interrogation_Position=1186; Antisense; GTACCTTCCCTGTCTGGGAAACGAT
>probe:Drosophila_2:1640868_at:411:391; Interrogation_Position=1203; Antisense; GAAACGATCGCCAGCTGTCCAAACA
>probe:Drosophila_2:1640868_at:52:453; Interrogation_Position=1271; Antisense; GATCTGCTGCGCTGAATTCCCGGAT
>probe:Drosophila_2:1640868_at:126:309; Interrogation_Position=1303; Antisense; CCAGTCCCAAGTACTATTCTCAGTT
>probe:Drosophila_2:1640868_at:375:691; Interrogation_Position=1359; Antisense; TTTGTATATATTGCCTGGAGCCCAG
>probe:Drosophila_2:1640868_at:186:553; Interrogation_Position=1375; Antisense; GGAGCCCAGTAGTGAATTACCGCTT
>probe:Drosophila_2:1640868_at:156:383; Interrogation_Position=910; Antisense; GAACTTTGACTTTGACAACTCCGCC
>probe:Drosophila_2:1640868_at:464:193; Interrogation_Position=926; Antisense; AACTCCGCCTTGTTCGATGACAGCG
>probe:Drosophila_2:1640868_at:513:611; Interrogation_Position=958; Antisense; TGACGAGGACCTCATGCTCTTCAGT
>probe:Drosophila_2:1640868_at:694:643; Interrogation_Position=975; Antisense; TCTTCAGTGGCGGTGAGGACTTCGA

Paste this into a BLAST search page for me
ATGATGGATCCTTTGACTTGGCCGATGAGAACCAAGATGCCGCTGCCGGAAAGCAGATCACACCCGTCGTGAAGAAGCGTCGTCGGATGCAGAACCTCAAGTACCTTCCCTGTCTGGGAAACGATGAAACGATCGCCAGCTGTCCAAACAGATCTGCTGCGCTGAATTCCCGGATCCAGTCCCAAGTACTATTCTCAGTTTTTGTATATATTGCCTGGAGCCCAGGGAGCCCAGTAGTGAATTACCGCTTGAACTTTGACTTTGACAACTCCGCCAACTCCGCCTTGTTCGATGACAGCGTGACGAGGACCTCATGCTCTTCAGTTCTTCAGTGGCGGTGAGGACTTCGA

Full Affymetrix probeset data:

Annotations for 1640868_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime