FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640871_at:

>probe:Drosophila_2:1640871_at:404:695; Interrogation_Position=1864; Antisense; TTTCCAGCCAACTACGTGCAGGTGG
>probe:Drosophila_2:1640871_at:437:349; Interrogation_Position=1881; Antisense; GCAGGTGGTGGGACAGAACTCATAA
>probe:Drosophila_2:1640871_at:577:173; Interrogation_Position=1905; Antisense; AAAGCTTCCAATTGAAATTCACGAT
>probe:Drosophila_2:1640871_at:505:661; Interrogation_Position=1998; Antisense; TAAACCAATTCGCAACTAACCCAGC
>probe:Drosophila_2:1640871_at:95:631; Interrogation_Position=2028; Antisense; TCCCATCCATTGTTTACCCTCTTAA
>probe:Drosophila_2:1640871_at:541:305; Interrogation_Position=2045; Antisense; CCTCTTAACCCTCCAAATTATGTGC
>probe:Drosophila_2:1640871_at:527:241; Interrogation_Position=2060; Antisense; AATTATGTGCAACGAATGGCTAGAT
>probe:Drosophila_2:1640871_at:601:727; Interrogation_Position=2097; Antisense; TTGTAATTTGTTATGCTAGCACTTA
>probe:Drosophila_2:1640871_at:592:599; Interrogation_Position=2110; Antisense; TGCTAGCACTTAAAGTAACCGTGGT
>probe:Drosophila_2:1640871_at:639:489; Interrogation_Position=2124; Antisense; GTAACCGTGGTATTCCATTTTTGAT
>probe:Drosophila_2:1640871_at:2:313; Interrogation_Position=2214; Antisense; GCCAAGCTATTTTAGATATCTCTCA
>probe:Drosophila_2:1640871_at:469:217; Interrogation_Position=2307; Antisense; AAGTCTACGAGAGTTTCCCGTGTCA
>probe:Drosophila_2:1640871_at:403:719; Interrogation_Position=2321; Antisense; TTCCCGTGTCAGGTGATCTGATCTA
>probe:Drosophila_2:1640871_at:655:89; Interrogation_Position=2375; Antisense; AGTCACAAACAAAAAGTCTGCTCTT

Paste this into a BLAST search page for me
TTTCCAGCCAACTACGTGCAGGTGGGCAGGTGGTGGGACAGAACTCATAAAAAGCTTCCAATTGAAATTCACGATTAAACCAATTCGCAACTAACCCAGCTCCCATCCATTGTTTACCCTCTTAACCTCTTAACCCTCCAAATTATGTGCAATTATGTGCAACGAATGGCTAGATTTGTAATTTGTTATGCTAGCACTTATGCTAGCACTTAAAGTAACCGTGGTGTAACCGTGGTATTCCATTTTTGATGCCAAGCTATTTTAGATATCTCTCAAAGTCTACGAGAGTTTCCCGTGTCATTCCCGTGTCAGGTGATCTGATCTAAGTCACAAACAAAAAGTCTGCTCTT

Full Affymetrix probeset data:

Annotations for 1640871_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720