Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640872_at:

>probe:Drosophila_2:1640872_at:217:411; Interrogation_Position=110; Antisense; GATCATTAAGGCGTCCACAGGTTTG
>probe:Drosophila_2:1640872_at:200:153; Interrogation_Position=126; Antisense; ACAGGTTTGACTGGACTCGCCGTGT
>probe:Drosophila_2:1640872_at:190:397; Interrogation_Position=16; Antisense; GACACTTCACAGCACTGGGCAACAG
>probe:Drosophila_2:1640872_at:528:157; Interrogation_Position=166; Antisense; ACACGCTGAGTGCTCTGTATGGCAA
>probe:Drosophila_2:1640872_at:629:9; Interrogation_Position=192; Antisense; ATTCTGCGGGCGGTGTCCAAGATGC
>probe:Drosophila_2:1640872_at:553:359; Interrogation_Position=235; Antisense; GCAAGTACACGGAGCAACTGGTCAA
>probe:Drosophila_2:1640872_at:78:197; Interrogation_Position=250; Antisense; AACTGGTCAAGCAGCGCGCCGATTC
>probe:Drosophila_2:1640872_at:398:463; Interrogation_Position=270; Antisense; GATTCTGTGGCCCAACACAAGGACA
>probe:Drosophila_2:1640872_at:498:225; Interrogation_Position=288; Antisense; AAGGACATCACTGCCCTGGAAAAGG
>probe:Drosophila_2:1640872_at:511:437; Interrogation_Position=333; Antisense; GAGGAGCTAATTGTCCAGGCCGAGA
>probe:Drosophila_2:1640872_at:98:109; Interrogation_Position=355; Antisense; AGAACGAGCTGATCCTTGCGCGCAA
>probe:Drosophila_2:1640872_at:255:167; Interrogation_Position=379; Antisense; AAATGCTCGGCTGGAAGCCCTGGGA
>probe:Drosophila_2:1640872_at:530:553; Interrogation_Position=461; Antisense; GGAGCCCAAGGTTTAGATTCACACT
>probe:Drosophila_2:1640872_at:58:205; Interrogation_Position=543; Antisense; AAGCCAGTGGCTTTATCAGCTAAAA

Paste this into a BLAST search page for me
GATCATTAAGGCGTCCACAGGTTTGACAGGTTTGACTGGACTCGCCGTGTGACACTTCACAGCACTGGGCAACAGACACGCTGAGTGCTCTGTATGGCAAATTCTGCGGGCGGTGTCCAAGATGCGCAAGTACACGGAGCAACTGGTCAAAACTGGTCAAGCAGCGCGCCGATTCGATTCTGTGGCCCAACACAAGGACAAAGGACATCACTGCCCTGGAAAAGGGAGGAGCTAATTGTCCAGGCCGAGAAGAACGAGCTGATCCTTGCGCGCAAAAATGCTCGGCTGGAAGCCCTGGGAGGAGCCCAAGGTTTAGATTCACACTAAGCCAGTGGCTTTATCAGCTAAAA

Full Affymetrix probeset data:

Annotations for 1640872_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime