FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640877_at:

>probe:Drosophila_2:1640877_at:559:623; Interrogation_Position=1021; Antisense; TGCGACTGCAGCACGTGTAGGCGTT
>probe:Drosophila_2:1640877_at:384:513; Interrogation_Position=1035; Antisense; GTGTAGGCGTTACACACGCTCGTAC
>probe:Drosophila_2:1640877_at:547:725; Interrogation_Position=1102; Antisense; TTGAGCATACACAACGTGGCCTACC
>probe:Drosophila_2:1640877_at:696:521; Interrogation_Position=1117; Antisense; GTGGCCTACCAGCTCAGGCTGATGA
>probe:Drosophila_2:1640877_at:421:547; Interrogation_Position=1152; Antisense; GGAGGCCATTCAGCGCGATGAGTTC
>probe:Drosophila_2:1640877_at:621:265; Interrogation_Position=1180; Antisense; CAGTTCGTCGCGGACTTTATGGCGA
>probe:Drosophila_2:1640877_at:628:699; Interrogation_Position=1195; Antisense; TTTATGGCGAGACACTTCAAGGCGG
>probe:Drosophila_2:1640877_at:118:201; Interrogation_Position=1220; Antisense; AACCTGTTCCGGCTTGGATACGAGA
>probe:Drosophila_2:1640877_at:21:423; Interrogation_Position=1241; Antisense; GAGAAGCTCTGTCTGCCGTAAACAT
>probe:Drosophila_2:1640877_at:82:491; Interrogation_Position=1258; Antisense; GTAAACATCCAGCTGCCTGCGGATC
>probe:Drosophila_2:1640877_at:418:81; Interrogation_Position=1358; Antisense; AGGTGGCCTCCAGCTAACATCATCA
>probe:Drosophila_2:1640877_at:10:359; Interrogation_Position=1387; Antisense; GCAACCTTTGTGTTTTGATAACCCA
>probe:Drosophila_2:1640877_at:575:171; Interrogation_Position=1411; Antisense; AAAGTTCCGACTAAGAGGCATTTCT
>probe:Drosophila_2:1640877_at:44:491; Interrogation_Position=987; Antisense; GTACAAACTGGACATGGAGCCCATT

Paste this into a BLAST search page for me
TGCGACTGCAGCACGTGTAGGCGTTGTGTAGGCGTTACACACGCTCGTACTTGAGCATACACAACGTGGCCTACCGTGGCCTACCAGCTCAGGCTGATGAGGAGGCCATTCAGCGCGATGAGTTCCAGTTCGTCGCGGACTTTATGGCGATTTATGGCGAGACACTTCAAGGCGGAACCTGTTCCGGCTTGGATACGAGAGAGAAGCTCTGTCTGCCGTAAACATGTAAACATCCAGCTGCCTGCGGATCAGGTGGCCTCCAGCTAACATCATCAGCAACCTTTGTGTTTTGATAACCCAAAAGTTCCGACTAAGAGGCATTTCTGTACAAACTGGACATGGAGCCCATT

Full Affymetrix probeset data:

Annotations for 1640877_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720