FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640878_at:

>probe:Drosophila_2:1640878_at:427:81; Interrogation_Position=115; Antisense; AGGGATCTCTACTACAGGAACCGCG
>probe:Drosophila_2:1640878_at:159:61; Interrogation_Position=13; Antisense; ATGTCTTTGAAGCTGTTCTCCTGCC
>probe:Drosophila_2:1640878_at:708:325; Interrogation_Position=137; Antisense; GCGATCTCTACAATCTACGACGTTT
>probe:Drosophila_2:1640878_at:366:623; Interrogation_Position=150; Antisense; TCTACGACGTTTCTACGATGGCTTC
>probe:Drosophila_2:1640878_at:251:211; Interrogation_Position=178; Antisense; AAGAAGTACAATCCCTACATCGCCG
>probe:Drosophila_2:1640878_at:529:61; Interrogation_Position=236; Antisense; ATGTGAACTACGGAGCGGGCTCCTA
>probe:Drosophila_2:1640878_at:707:523; Interrogation_Position=252; Antisense; GGGCTCCTATTCCTACAACTATGAG
>probe:Drosophila_2:1640878_at:119:251; Interrogation_Position=346; Antisense; CAAGTTGAGGGTGCTTATTCGTTCA
>probe:Drosophila_2:1640878_at:80:689; Interrogation_Position=361; Antisense; TATTCGTTCATTACACCCGAGGGTC
>probe:Drosophila_2:1640878_at:344:431; Interrogation_Position=395; Antisense; GAGTCAAGTACCTGGCTGATGCCAA
>probe:Drosophila_2:1640878_at:578:681; Interrogation_Position=442; Antisense; TATGATGGTGTGAACTCCGCTTTTT
>probe:Drosophila_2:1640878_at:494:381; Interrogation_Position=453; Antisense; GAACTCCGCTTTTTATGCCGGACAG
>probe:Drosophila_2:1640878_at:484:125; Interrogation_Position=480; Antisense; AGCCCCTGCCAATGTAGTCTATACA
>probe:Drosophila_2:1640878_at:122:655; Interrogation_Position=81; Antisense; TCAATACAATCCCTATCTGCGCAAT

Paste this into a BLAST search page for me
AGGGATCTCTACTACAGGAACCGCGATGTCTTTGAAGCTGTTCTCCTGCCGCGATCTCTACAATCTACGACGTTTTCTACGACGTTTCTACGATGGCTTCAAGAAGTACAATCCCTACATCGCCGATGTGAACTACGGAGCGGGCTCCTAGGGCTCCTATTCCTACAACTATGAGCAAGTTGAGGGTGCTTATTCGTTCATATTCGTTCATTACACCCGAGGGTCGAGTCAAGTACCTGGCTGATGCCAATATGATGGTGTGAACTCCGCTTTTTGAACTCCGCTTTTTATGCCGGACAGAGCCCCTGCCAATGTAGTCTATACATCAATACAATCCCTATCTGCGCAAT

Full Affymetrix probeset data:

Annotations for 1640878_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720