FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640879_at:

>probe:Drosophila_2:1640879_at:293:251; Interrogation_Position=4340; Antisense; CAAGGCAGTGCTCCGGCTTTCAGAG
>probe:Drosophila_2:1640879_at:454:341; Interrogation_Position=4355; Antisense; GCTTTCAGAGCATGTCCTGGGACGA
>probe:Drosophila_2:1640879_at:642:83; Interrogation_Position=4426; Antisense; AGTGGTGGCCTTTCCATACTGGGCT
>probe:Drosophila_2:1640879_at:629:27; Interrogation_Position=4441; Antisense; ATACTGGGCTCCTTTAGGATTCCAC
>probe:Drosophila_2:1640879_at:5:423; Interrogation_Position=4550; Antisense; GAGAAGCATTATATCCACCCAGAAG
>probe:Drosophila_2:1640879_at:174:447; Interrogation_Position=4575; Antisense; GATGCGGCGCATTCTTATGACCAGA
>probe:Drosophila_2:1640879_at:107:611; Interrogation_Position=4592; Antisense; TGACCAGACCGATTTCAAGGCCAAG
>probe:Drosophila_2:1640879_at:657:223; Interrogation_Position=4614; Antisense; AAGGAGACCAGTACTTCGTCCATCC
>probe:Drosophila_2:1640879_at:144:173; Interrogation_Position=4642; Antisense; AAAGCTAATGCTCCCATTCTGAAGG
>probe:Drosophila_2:1640879_at:150:225; Interrogation_Position=4663; Antisense; AAGGAGAACAGAACCCTGCTGCTCA
>probe:Drosophila_2:1640879_at:468:361; Interrogation_Position=4691; Antisense; GCAATCCCTTTCGAAACTTGAGCTT
>probe:Drosophila_2:1640879_at:638:293; Interrogation_Position=4729; Antisense; CGAGAAGTTATTGTCCTGCATCCGC
>probe:Drosophila_2:1640879_at:401:579; Interrogation_Position=4769; Antisense; GGCCATCGAAAAACTCCTTCAGCAA
>probe:Drosophila_2:1640879_at:192:215; Interrogation_Position=4832; Antisense; AAGATACCGTTGTGAAGCCCGTGCC

Paste this into a BLAST search page for me
CAAGGCAGTGCTCCGGCTTTCAGAGGCTTTCAGAGCATGTCCTGGGACGAAGTGGTGGCCTTTCCATACTGGGCTATACTGGGCTCCTTTAGGATTCCACGAGAAGCATTATATCCACCCAGAAGGATGCGGCGCATTCTTATGACCAGATGACCAGACCGATTTCAAGGCCAAGAAGGAGACCAGTACTTCGTCCATCCAAAGCTAATGCTCCCATTCTGAAGGAAGGAGAACAGAACCCTGCTGCTCAGCAATCCCTTTCGAAACTTGAGCTTCGAGAAGTTATTGTCCTGCATCCGCGGCCATCGAAAAACTCCTTCAGCAAAAGATACCGTTGTGAAGCCCGTGCC

Full Affymetrix probeset data:

Annotations for 1640879_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720