FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640881_at:

>probe:Drosophila_2:1640881_at:611:639; Interrogation_Position=193; Antisense; TCGGTGGCATGTTTCGGTGGCTACA
>probe:Drosophila_2:1640881_at:441:533; Interrogation_Position=220; Antisense; GGTGAATCCAACCTGATCGCGGAGC
>probe:Drosophila_2:1640881_at:388:167; Interrogation_Position=265; Antisense; AAATGCTACAATGCGGCGGCGGACT
>probe:Drosophila_2:1640881_at:109:223; Interrogation_Position=295; Antisense; AAGGGTATCGATGCCGACTTCCTGG
>probe:Drosophila_2:1640881_at:296:557; Interrogation_Position=329; Antisense; GGACTATCCGACTTTCATCCGAAAG
>probe:Drosophila_2:1640881_at:80:101; Interrogation_Position=352; Antisense; AGAGTTTGCAGCGAGCTCAGGGCTT
>probe:Drosophila_2:1640881_at:678:81; Interrogation_Position=370; Antisense; AGGGCTTGCAACGAGCTCAACACAA
>probe:Drosophila_2:1640881_at:185:197; Interrogation_Position=393; Antisense; AACCCTCGAATCCTTTCAATGTCAT
>probe:Drosophila_2:1640881_at:17:231; Interrogation_Position=421; Antisense; AATGTGGGCTCCAACAACACTGTCT
>probe:Drosophila_2:1640881_at:517:151; Interrogation_Position=448; Antisense; ACATACAGCATCTCGGGTAACGCCT
>probe:Drosophila_2:1640881_at:577:673; Interrogation_Position=502; Antisense; TACCGAGTGGTAGATCTGCGCCATG
>probe:Drosophila_2:1640881_at:152:519; Interrogation_Position=559; Antisense; GTGGAGTCCACTGCCAGGAACTACA
>probe:Drosophila_2:1640881_at:621:561; Interrogation_Position=575; Antisense; GGAACTACAACTACCTGCAGGCCTG
>probe:Drosophila_2:1640881_at:718:69; Interrogation_Position=593; Antisense; AGGCCTGTCTGGATGGTCGCGCTAA

Paste this into a BLAST search page for me
TCGGTGGCATGTTTCGGTGGCTACAGGTGAATCCAACCTGATCGCGGAGCAAATGCTACAATGCGGCGGCGGACTAAGGGTATCGATGCCGACTTCCTGGGGACTATCCGACTTTCATCCGAAAGAGAGTTTGCAGCGAGCTCAGGGCTTAGGGCTTGCAACGAGCTCAACACAAAACCCTCGAATCCTTTCAATGTCATAATGTGGGCTCCAACAACACTGTCTACATACAGCATCTCGGGTAACGCCTTACCGAGTGGTAGATCTGCGCCATGGTGGAGTCCACTGCCAGGAACTACAGGAACTACAACTACCTGCAGGCCTGAGGCCTGTCTGGATGGTCGCGCTAA

Full Affymetrix probeset data:

Annotations for 1640881_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720