Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640883_a_at:

>probe:Drosophila_2:1640883_a_at:414:255; Interrogation_Position=474; Antisense; CACAAATTCGGACATAACTGGGTAT
>probe:Drosophila_2:1640883_a_at:263:485; Interrogation_Position=495; Antisense; GTATGTACATAGTTTTCCCCTCAAG
>probe:Drosophila_2:1640883_a_at:644:651; Interrogation_Position=515; Antisense; TCAAGAATTGGACCCAAGCCCCTGT
>probe:Drosophila_2:1640883_a_at:325:205; Interrogation_Position=530; Antisense; AAGCCCCTGTGCAACCAAAATTGGA
>probe:Drosophila_2:1640883_a_at:704:21; Interrogation_Position=561; Antisense; ATATTTATCCACAATCAGCTTCATT
>probe:Drosophila_2:1640883_a_at:504:237; Interrogation_Position=573; Antisense; AATCAGCTTCATTGCATATTACATA
>probe:Drosophila_2:1640883_a_at:78:495; Interrogation_Position=601; Antisense; GTCAACTTGTTGTCCCTACTTATGT
>probe:Drosophila_2:1640883_a_at:92:481; Interrogation_Position=624; Antisense; GTATTTGTTTTGTGCACGACCTTAA
>probe:Drosophila_2:1640883_a_at:26:511; Interrogation_Position=635; Antisense; GTGCACGACCTTAAGTTTATAGTAG
>probe:Drosophila_2:1640883_a_at:486:93; Interrogation_Position=678; Antisense; AGTTCGCTACTGAATTTACGCCTCA
>probe:Drosophila_2:1640883_a_at:689:647; Interrogation_Position=700; Antisense; TCATGCAAATGTTCTGCTTTCCTAA
>probe:Drosophila_2:1640883_a_at:420:603; Interrogation_Position=709; Antisense; TGTTCTGCTTTCCTAAACACTGCTT
>probe:Drosophila_2:1640883_a_at:182:145; Interrogation_Position=727; Antisense; ACTGCTTCCAAAACTACTGCCGGTA
>probe:Drosophila_2:1640883_a_at:464:191; Interrogation_Position=738; Antisense; AACTACTGCCGGTAAATCACCGAAT

Paste this into a BLAST search page for me
CACAAATTCGGACATAACTGGGTATGTATGTACATAGTTTTCCCCTCAAGTCAAGAATTGGACCCAAGCCCCTGTAAGCCCCTGTGCAACCAAAATTGGAATATTTATCCACAATCAGCTTCATTAATCAGCTTCATTGCATATTACATAGTCAACTTGTTGTCCCTACTTATGTGTATTTGTTTTGTGCACGACCTTAAGTGCACGACCTTAAGTTTATAGTAGAGTTCGCTACTGAATTTACGCCTCATCATGCAAATGTTCTGCTTTCCTAATGTTCTGCTTTCCTAAACACTGCTTACTGCTTCCAAAACTACTGCCGGTAAACTACTGCCGGTAAATCACCGAAT

Full Affymetrix probeset data:

Annotations for 1640883_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime