FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640884_at:

>probe:Drosophila_2:1640884_at:23:629; Interrogation_Position=1195; Antisense; TCCAGCTCCGATGGCGAAGTGCAGA
>probe:Drosophila_2:1640884_at:424:373; Interrogation_Position=1210; Antisense; GAAGTGCAGAAGATTCCCCATCGAC
>probe:Drosophila_2:1640884_at:290:691; Interrogation_Position=1273; Antisense; TTTGGTCCGCGCCATGAAGGTTACC
>probe:Drosophila_2:1640884_at:561:729; Interrogation_Position=1331; Antisense; TTGGTCCACATCATGGTCCATTTGT
>probe:Drosophila_2:1640884_at:197:19; Interrogation_Position=1350; Antisense; ATTTGTCGAACATGGACATGGCCCC
>probe:Drosophila_2:1640884_at:576:249; Interrogation_Position=1375; Antisense; CAATTCGGACCATTCTTTGACGTTC
>probe:Drosophila_2:1640884_at:312:615; Interrogation_Position=1416; Antisense; TGAAGGACCGCGTTTTGAGCACCAG
>probe:Drosophila_2:1640884_at:440:549; Interrogation_Position=1449; Antisense; GGAGTTTCCTATTGCCCATCATCGA
>probe:Drosophila_2:1640884_at:375:113; Interrogation_Position=1544; Antisense; AGCAGGAGAGTTTCCCCAAAGTCGA
>probe:Drosophila_2:1640884_at:278:141; Interrogation_Position=1601; Antisense; ACGGAAAACGCGCTCATGGACATGG
>probe:Drosophila_2:1640884_at:177:409; Interrogation_Position=1667; Antisense; GACGTGATTAGGCAATCGCAGCCAG
>probe:Drosophila_2:1640884_at:41:637; Interrogation_Position=1682; Antisense; TCGCAGCCAGCGTTTAAGATGCATT
>probe:Drosophila_2:1640884_at:184:659; Interrogation_Position=1706; Antisense; TAAGATTCCTTCAATACAACCTCCC
>probe:Drosophila_2:1640884_at:446:29; Interrogation_Position=1755; Antisense; ATACATTTAACACCCAGAAGCTTCT

Paste this into a BLAST search page for me
TCCAGCTCCGATGGCGAAGTGCAGAGAAGTGCAGAAGATTCCCCATCGACTTTGGTCCGCGCCATGAAGGTTACCTTGGTCCACATCATGGTCCATTTGTATTTGTCGAACATGGACATGGCCCCCAATTCGGACCATTCTTTGACGTTCTGAAGGACCGCGTTTTGAGCACCAGGGAGTTTCCTATTGCCCATCATCGAAGCAGGAGAGTTTCCCCAAAGTCGAACGGAAAACGCGCTCATGGACATGGGACGTGATTAGGCAATCGCAGCCAGTCGCAGCCAGCGTTTAAGATGCATTTAAGATTCCTTCAATACAACCTCCCATACATTTAACACCCAGAAGCTTCT

Full Affymetrix probeset data:

Annotations for 1640884_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720